Molecular Exercise Physiology What is Molecular Exercise Physiology? Presentation 1 Henning Wackerhage - PowerPoint PPT Presentation

Loading...

PPT – Molecular Exercise Physiology What is Molecular Exercise Physiology? Presentation 1 Henning Wackerhage PowerPoint presentation | free to download - id: 3be4aa-ZmY5N



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Molecular Exercise Physiology What is Molecular Exercise Physiology? Presentation 1 Henning Wackerhage

Description:

DNA: The model X-ray of DNA (first by Wilkins, Franklin and colleagues at King's College, London) ... The coding alphabet consists of four letters ... – PowerPoint PPT presentation

Number of Views:351
Avg rating:3.0/5.0
Slides: 32
Provided by: basesOrg2
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Molecular Exercise Physiology What is Molecular Exercise Physiology? Presentation 1 Henning Wackerhage


1
Molecular Exercise Physiology What is Molecular
Exercise Physiology? Presentation 1 Henning
Wackerhage
2
Important
The online presentations on Molecular Exercise
Physiology may be used for self-teaching purposes
for Molecular Exercise Physiology-SIG members.
However, the must not be used for teaching
students without prior authorisation. If we wish
to use some of these slides for your
presentations to students, please contact Dr
Henning Wackerhage Senior Lecturer in Molecular
Exercise Physiology University of
Aberdeen E-mail h.wackerhage_at_abdn.ac.uk
3
Learning outcomes
  • At the end of this presentation you should be
    able to
  • Define the term Molecular Exercise Physiology and
    give examples for research questions in Molecular
    Exercise Physiology.
  • Explain how a gene is transcribed and translated
    into a protein.
  • Explain how exercise-activated signal
    transduction pathways may regulate transcription
    and translation of proteins.

4
Introduction Part 1 What is Molecular Exercise
Physiology?
5
Definition
Prof. Frank Booth was one of the first
researchers in Cellular and Molecular Exercise
Physiology. See Booth FW Perspectives on
molecular and cellular exercise physiology. J.
Appl. Physiol, 65 1461-1471, 1988. Molecular
exercise physiology is a shortened version of the
term used by Booth. A narrow definition of the
term molecular exercise physiology is given
below
Molecular exercise physiology is the study of
signal transduction and genetics in relation to
exercise. Molecular exercise physiologists aim to
characterise the mechanisms that are responsible
for the adaptation of cells and organs to
exercise and to identify the genetic determinants
of athletic talent.
6
Applications of molecular exercise physiology
  • Possible applications are
  • Investigate the molecular basis of muscle
    adaptation to exercise.
  • Detect the signal transduction and gene
    regulation changes in states such as diabetes
    mellitus, muscle unloading or ageing and
    investigate whether exercise can reverse these
    changes.
  • Why study Molecular Exercise Physiology?
  • Because it can explain adaptations that have been
    described previously.
  • Because the research benefits from and advances
    other fields such as cancer and ageing research.
  • Major advances in knowledge occur at the moment
    while most other exercise research is not that
    novel.

7
Classical approach
?
Exercise
Adaptations
Black box
8
Molecular exercise physiology approach
Molecular Exercise Physiologist
Signal transduction gene regulation
Exercise
Adaptations
Black box
9
Examples
Classical exercise physiologists found that
endurance exercise increases the number of
capillaries in a muscle. Molecular exercise
physiologists try to identify the
exercise-activated signal transduction pathways
that are responsible for the growth of
capillaries. Classical exercise physiologists
have described the growth of muscle fibres in
response to resistance training. Molecular
exercise physiologists have identified how
exercise may activate regulators of
translation/protein synthesis. Classical exercise
physiologists have discovered that exercise makes
hearts grow (cause the athletes heart).
Molecular exercise physiologists have identified
candidate signal transduction pathways that may
regulate the growth of heart muscle cells. There
is much more to discover!
10
Introduction Part 2 DNA and all that
11
Definition
A gene is DNA that codes for a protein.
Please note Not all DNA is coding for proteins.
There are large non-coding regions and some genes
code just for RNA (will be explained
later). Task What is the difference between RNA
and DNA? What is mRNA and tRNA? Find out.
12
DNA The model
Watson and Crick used these and other data to
model DNA structure bases occur in CG and AT
pairs, double helix.
X-ray of DNA (first by Wilkins, Franklin and
colleagues at King's College, London)
13
DNA is coiled, supercoiled and packed
14
Human chromosomes (23 pairs)
Human beings have 23 pairs of chromosomes which
are densely packed DNA. However, most of the time
DNA is unravelled.
15
Genome information
  • Some facts about the human genome
  • Human genome size about 3,200 Mb (mega bases).
  • Estimated gene numbers human 31,000, yeast
    6000, fly 13,000, worm 18,000, plant 26,000.
  • Only 1.1 to 1.4 of the human sequence encodes
    protein. The rest is non-coding.
  • 28 of the sequence is transcribed into RNA (5
    of this is translated into proteins).
  • Only 94 of 1,278 protein families are specific to
    vertebrates.

16
How does DNA code for proteins?
DNA is a blueprint for proteins. The coding
alphabet consists of four letters (i.e. bases
plus one more in mRNA).
Purine bases
Base pairs Adenine- Thymine Guanine
Cytosine Uracil (instead of T in RNA)
Guanine (G)
Adenine (A)
Pyrimidine bases
Uracil (U, RNA)
Cytosine (C)
Thymine (T, DNA)
17
How does DNA code for proteins?
The bases are connected and form long DNA chains.
Here is a DNA sequence downloaded from the
Ensembl genome browser AGCTTATTCTGCATAATTAGAAAAG
AAAGACACCAAGCCATTTAAACATAATTTATGTACTTTATGGCTTTATAC
AATTATAGCAAAGATTGTTCTTGTGTCTGTAAGTACATCAACATCAGGCA
CTTCTCAGAGTATCGGAACAAGAACGTGGAATCTGCACTGTTACTAAACT
CGGGTAGCGAAATGCAGGAGGCATGACTACGTCCTGATGGGACTTACATG
GCCACCCCTGGCCACACTGCCAGGCTGTGC
18
Gene expression how it works
Reading a gene and producing a protein is a
two-step process First, a gene (red) is
transcribed into messenger RNA (mRNA orange) and
second, mRNA is translated into a
peptide/protein.
Gene
GTCTTTCAAATATTGAATATGACAAAGATGTTTACTGTACCAGATTG
DNA
Transcription
mRNA
UAUAACUUAUACUGUUUCUACAAAUGA
Translation
Peptide/protein
Peptide sequence Met (start) Asn Leu Tyr Cys Phe
Tyr Lys (termination)
19
How transcription works
Packed DNA
TF
Step 1. DNA is unravelled and activated
transcription factors (TF) bind to the DNA.
Pol II
TF
Step 2. RNA polymerase II (Pol II) is recruited
by the active, DNA-bound transcription factor.
TF
Pol II
Step 3. RNA polymerase transcribes gene (shown in
green) into mRNA (shown in red).
20
How translation works
Ribosomes are located in the cytosol which is
where mRNA is transported to. The mRNA (shown in
red) is translated into a polypeptide (shown as a
chain of ovals).
21
How to transcribe DNA into mRNA and how to
translate mRNA into protein?
If you know a DNA sequence then you can use the
genetic code to first transcribe the gene into
mRNA and second to translate mRNA into an amino
acid (protein) sequence. Some programmes on the
internet help you to achieve that. See task on
next page.
22
Task
Task Copy the DNA sequence below and convert it
first into mRNA sequence and then a peptide. Use
the following website www.nitrogenorder.org/cgi-b
in/nucleo.cgi. TGTCTTTCAAAAAAATGTGAAAACACTTTAATAT
AACTTATACTGTTTCTACAAATTAGA TGTAAGAAATAATTTCATTTAGT
CATAGTACAATAAATTTGATTAACAAAATCCCAATTT
ACAAAACAGAAGTAAATAAATGCAGAAATATATTCATTATCAAATTATAA
AATAAAAGTA ACAGTTATTGTTGAGATAGCATCAGTTTATTCTTCATTT
CAGATAATAGAGTCAATTATT TTGGTATACTTAGTAATGTTTTTGCAAG
TATTAAAATAATGGAACGTTGAGATTTAAACA
CAATGACAGTAAACCATTGAAATTTCAAATTCACTTTATACAGCCATCAT
GAATCCATAA GTGAATGTTAATCATGTAAAAAAATATAAAATGATTGTA
ATATAACCATCTAATCATTAA CATATGGAGTTTTAAGACCACTATTTAA
TCTGCTAATTTGCTCTGAAATATAAGTAGTTG
CTTTTCTGTGATGCATGACATGTCTTTGTGCCTTAGTACTTAATTTGAAA
TGTCCTTAGT GTAAAAATATACCAAAGTAAATAAAAAAGGAGACACTTA
TTTACAAAACAATATTGTATA CATATTATATAAATGCATTGTTTCAGTC
TTTTTATACAATATTGATAGAGTCGATCATTT
23
Important
You should have learned about transcription and
translation before and the presentation should
have been a revision. You will do well in this
module if you know transcription and translation
inside out. There are numerous websites and
textbooks in which transcription and translation
are described. Do not proceed until you can
explain the following terms and reactions
well DNA, intron, exon Transcription factor,
transcription factor binding site, RNA polymerase
II, mRNA Translation, peptide, protein
24
Introduction Part 3 Exercise changes
transcription and translation
25
Exercise regulates transcription and translation
Exercise stimulates acute and chronic adaptations
probably in every organ of the body. Many of
these adaptations are mediated by so-called
signal transduction pathways that regulate the
transcription and translation of genes. The
sequence of events is Exercise signals ?
activation/inhibition of signal transduction
pathway ? change in gene transcription,
translation or other cell function (
adaptation). Today, Molecular Exercise
Physiology researchers aim to trace this sequence
of events for many adaptations to exercise. Here,
I will briefly introduce how trancription and
translation may be regulated by exercise.
26
How exercise may regulate transcription
Exercise signal
(1)
P
Transcription
(2)
mRNA
P
P
Nucleus
(1) In this model, an exercise signal (such as
calcium, stretch, energy stress) leads to the
activation of a signalling protein (green) by
phosphorylation. (2) The signalling protein then
phosphorylates a transcription factor (blue)
which promotes the translocation of the
transcription factor into the nucleus. (3) The
transcription factor binds to the DNA which
increases the transcription of a gene (i.e.
increase in mRNA).
27
Exercise regulates transcription
Example Zambon et al. (2003) used so-called DNA
microarrays (gene chips) in order to identify
genes whose expression (i.e. whose mRNA content)
was changed in muscle 6 h after resistance
training. DNA microarrays allowed the researchers
to measure the gene expression of 20,000 genes in
one two-day experiment. The table below contains
some results (the real results table consists of
20,000 rows!). Column 1 in the table below gives
a gene description, column 2 the fold change
(exercised versus non-exercised leg) and the
p-value indicates the significance of the change.
The data indicate that the mRNA of the first
three genes was significantly decreased (negative
change ) and of that the mRNA of the fourth gene
was significantly increased 6 h after resistance
exercise.
28
Exercise regulates translation
Exercise signal
(1)
P
P
(2)
mRNA
Protein
Translation
Nucleus
(1) In this model, an exercise signal (such as
calcium, stretch, energy stress) leads to the
activation of a signalling protein (green) by
phosphorylation. (2) The signalling protein then
phosphorylates a protein (orange) which increases
the translation of mRNA into protein (which is
protein synthesis). Muscle protein synthesis and
translation signalling can be increased for 48 h
after resistance exercise.
29
Exercise regulates translation
Translation is the process in which mRNA is used
as a blueprint to assemble proteins from amino
acids. Thus, translation is protein
synthesis. In the recent five years researchers
have shown that strength training can increase
the general rate of translation. In addition,
many of the regulatory proteins that regulate
translation have been identified. Example The
figure is taken from Baar and Esser (1999) and
shows a Western blot of the p70 S6k protein which
is involved in the regulation of
translation/protein synthesis.
The p70 S6k bands are shifted upwards in response
to insulin and 3 h and 6 h after resistance
exercise. The changed banding indicates that the
protein is activated in these situations.
30
Task
a) How do the following methods work and how may
the be used for Molecular Exercise Physiology
research questions? - RT-PCR - Western blots -
DNA microarray - SNP chips b) Find two research
papers each in which the authors investigate the
effect of exercise on gene expression (i.e.
transcription of a gene) and translation. Use
PubMed for your search.
Revise this presentation several times and do a
lot of additional reading. This material is
crucial for the rest of the module.
31
The End
About PowerShow.com