Genetics 101 - PowerPoint PPT Presentation

Loading...

PPT – Genetics 101 PowerPoint presentation | free to download - id: 3b5e57-Nzg5M



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Genetics 101

Description:

101 April 23, 1953 Completion of the Human Genome Project April 14, 2003 What is DNA? Image from U.S. Department of Energy Human Genome Program http://www.ornl.gov ... – PowerPoint PPT presentation

Number of Views:110
Avg rating:3.0/5.0
Slides: 33
Provided by: genetical
Category:
Tags: genetics

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Genetics 101


1
Genetics101
2
April 23, 1953
Watson Cricks discovery of the DNA helix
3
Completion of the Human Genome ProjectApril 14,
2003
GGCACGAGGGTAAATATGGCATAAGTTAATAACA
CTTTTCCCCAAAATGGTGCTTTGGATTTGAAAAGG
GTCTGATGGGGAGAAGGAGAACGTATCATCCTAGC
TTCCTCTCTTAATAAACCTAGAAAAACGGGTAGTA
AACTGTGGATAGTCAGGAAAACACCCAGCAAGGGA CACAGC
TGTCAGGAAATGAATCTTCCCCCCAACCC CCACCATGCAGATGGATAG
ACAGAATCTTTCCTGA CTAGTCATTAGGATCAGGGGCCTCTGTTGGAT
TTGT GTTTCTTGAAGAATAGCTGGCAGAGTGGTATAAAA
GACACGAATATCTCCTGGTCTATAAGGATACTCTGA
TTTGGGGTTTGCATTTTTCATGGTTTTTATTTCCTGT
TCCCCCTGGAGTTTTCCATTAGTGAGTTTTTG
Entering the Genomic Era
4
What is DNA?
5
Image from the National Cancer Institute
6
  • Image from U.S. Department of Energy Human Genome
    Program http//www.ornl.gov/hgmis

7
WHAT IS THE HUMAN GENOME PROJECT?
8
AN INTERNATIONAL COLLABORATIVE EFFORT OF
SCIENTISTS
  • United Kingdom
  • France
  • Germany
  • Japan
  • China
  • United States
  • Led by the National Human Genome Institute,
  • National Institutes of Health in Bethesda, MD
  • http//www.genome.gov

9
GOAL ACHIEVED
  • To Spell Out All of the Base Pairs in the
    Human Genome

10
What is the big deal about knowing the code?
11
Apply basic scientific findings to health
12
Genetics in the news
Slide 12
13
Genetics in the news
Slide 13
14
Chromosomes
Slide14
15
How a dominant trait is inherited
Slide15
16
How a recessive trait is inherited
Slide16
17
Our genetic story is expressed through our family
history
18
  • Pedigree of a Family with Whirling Disorder
  • (discovered by the
  • Genetic Science Learning Center at the University
    of Utah)

19
And if we know all of this what next?
20
Genetic Testing
  • Prenatal screening,
  • newborn screening, genotyping,
  • predictive testing,
  • prognostic testing,
  • cancer profiling,
  • infectious disease testing

21
Interventions, TreatmentsTherapies
  • Pharmacogenomics, gene therapy

22
Forensic Applications
  • DNA testing for positive identification of
    missing persons, or human remains for
    exonerating unjustly incarcerated prisoners

23
Non-medical Uses
  • Paternity, Enhancement,
  • Comparative Genomics, Human History

24
Ethical, Legal and Social Implications
25
Privacy and Genetic Nondiscrimination
Disparities Human Research Participant
Protections Reproductive Decision Making
26
Who Works on this Stuff?
27
ResearchersCliniciansEthicistsPolicy Makers
28
Who Makes the Decisions?
29
YouYour FamilyYour CommunityOur Policy Makers
30
Informed Decision Making
I
Healthcare Enterprise
POLICY
31
WELCOME TO THE GENOME ERA!!
32
Credits
  • Author Sharon Terry, President CEO, Genetic
    Alliance
  • Reviewers
  • Emily Soper, Information Specialist, Genetics and
    Rare Disease Information Center
  • Roxane Brown, Outreach Program Manager
  • Patrick Terry, Director of Consumer Advocacy,
    Genomic Health

We also express our appreciation to National
Human Genome Research Institute (NHGRI), NIH,
DHHS Genetic Services Branch, Maternal and Child
Health, DHHS Office of Rare Diseases, NIH,
DHHS Department of Energy, DHHS
About PowerShow.com