U.S. Animal Detectives Fight Crime in Forensics Lab - PowerPoint PPT Presentation

Loading...

PPT – U.S. Animal Detectives Fight Crime in Forensics Lab PowerPoint presentation | free to view - id: 19969-NTQ3N



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

U.S. Animal Detectives Fight Crime in Forensics Lab

Description:

Asian medicinals (rhino horn pills, tiger bone juice... Dried skin from tiger, leopard, clouded leopard, snow leopard, leopard cat, ... – PowerPoint PPT presentation

Number of Views:256
Avg rating:3.0/5.0
Slides: 37
Provided by: kpai
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: U.S. Animal Detectives Fight Crime in Forensics Lab


1
U.S. Animal Detectives Fight Crime in Forensics
Lab
  • Crimes against wildlife include illegal hunting,
    trafficking in endangered species, and producing
    and selling products made from endangered or
    threatened species
  • The task of sleuthing and solving these crimes
    falls to a federal laboratory in Ashland, Oregon

2
U.S. Fish and Wildlife ServiceNational Fish and
Wildlife Forensics LaboratoryScotland Yard for
Animals
  • Only lab in the world dedicated to solving
    wildlife crimes
  • Lab works with federal agents, the 50 state Fish
    and Game Commissions and the roughly 155
    countries that are signatories to CITES the
    Convention on International Trade in Endangered
    Species of Wild Fauna and Flora that oversees
    trade in wild plants and animals
  • Every year the lab currently a team of 33
    handles about 900 cases

3
Ken Goddard
4
http//www.lab.fws.gov/labs/index.html
5
Michigan Department of Natural Resources, Law
Enforcement Division Lab Director or Forensic
Specialist Name Dr. Stephen M. Schmitt,
D.V.M. Title Wildlife Veterinarian Address Rose
Lake Wildlife Disease Lab, 8562 East Stoll
Road City East Lansing State/province
Michigan Postal Code 48823 Telephone
517-373-9358 Fax 517-641-6022 E-mail
schmitts_at_state.mi.us How many staff work on
wildlife forensics? Three (3) Part Time What
forensic techniques are available at (within)
your laboratory? Cause of death determination,
X-ray, aging techniques, species identification,
some hair, identification and elimination. What
species can be identified with these techniques?
Deer, beaver What new forensic techniques or
other data are being developed within your
laboratory? None. We do the work as a service to
our Law Enforcement Division and fit the work
into our existing schedules, which deal primarily
with wildlife disease and various furbearer and
bear surveys.
6
  Alaska Department of Public Safety Lab Director
or Forensic Specialist Name Jim Wolfe Title
Criminalist III Address Alaska State Crime
Laboratory, 5500 E. Tudor Road City
Anchorage State/province Alaska Postal Code
Telephone 904-269-5683 Fax 907-338-6614 E-mail
james_wolfe_at_dps.state.ak.us How many staff work
on wildlife forensics? One (1) Part Time What
forensic techniques are available at (within)
your laboratory? The Alaska State Crime Lab
provides Forensic science support for all law
enforcement agencies in the state, including all
wildlife law enforcement agencies. We provide
analyses n most of the standard forensic
techniques, i.e., firearm/tool marks,
fingerprints, trace evidence, shoe prints/tire
tracks, etc., and also provide the following
wildlife specific techniquesspecies
identification of big game hairs, physical
matching of game animal parts and post-mortem
exams. What species can be identified with these
techniques? We no longer do species
identification of meat and blood. The hair
identification can identify hairs from Alaskan
cervids moose, elk, caribou, blacktail
deer. Other comments about your lab or
capabilities We are finding that the requests
for wildlife specific tests are limited (partly
because we have our wildlife officers send meat
and blood evidence for species identification and
DNA directly to the USFWS laboratory). Last year
30 cases came in from Wildlife Law Enforcement
agencies and only three cases requested wildlife
specific tests. The rest of the cases included
analyses such as fingerprints, shoeprints, etc.
7
Examples of evidence items that are sent for
examination
  • blood samples (ideally, in a fresh or dried
    condition)
  • tissue samples (same as above, only include
    frozen)
  • whole carcasses (same as the above, except we're
    rarely that lucky)
  • bones
  • teeth
  • claws
  • talons
  • tusks
  • hair
  • hides
  • furs
  • feathers
  • leather goods (purses, shoes, boots...)
  • poisons
  • Pesticides
  • stomach contents (uh huh)
  • projectiles (bullets, arrows...)
  • weapons (rifles, bows, traps....)
  • Asian medicinals (rhino horn pills, tiger bone
    juice...)
  • And pretty much anything else you might imagine
    that could have come from (or been made from) an
    animal.

8
Differences between Wildlife Crime and Police
Crime Labs
  • The only real difference between a wildlife crime
    lab, and a 'typical' police crime laboratory is
    that the victim is a nonhuman animal.
  • Whether they are police or wildlife oriented---do
    two things
  • They examine, identify, and compare evidence
    items using a wide range of scientific procedures
    and instruments...
  • And in a triangular manner, they attempt to link
    suspect, victim and crime scene with physical
    evidence.

9
Case Histories Molecular Genetic Approaches
10
Mitochondrial Genome
  • 17,000 bp, circular in structure
  • 37 genes involved in production storage of
    energy
  • 13 involved in oxidative phosphorylation
  • 22 transfer genes
  • 2 ribosomal RNAs

11
Molecular Genetic ApproachesMitochondrial
Control Region also known as the D-loop or the
Hypervariable Region
  • Control Region contains the signals that
    control RNA and DNA synthesis
  • Hypervariable region termed hypervariable
    because accumulates point mutations at a rate
    5-10 times that of nuclear DNA
  • (The high mutation rate of mtDNA is almost
    certainly due to the fact that the mt genome is
    located in close proximity to the respiratory
    machinery of the cell - a known source of potent
    mutagens called oxygen free radicals)
  • D-loop early phase of replication forming a loop

12
Detecting the Sale of Meat from Protected Whales
  • A global moratorium on commercial harvest of many
    cetacean species was established by the
    International Whaling Commission in 1985
  • But whaling never completely stopped whale
    meat continues to be sold in eastern Asia and
    Scandinavia
  • Could be from small cetaceans like porpoises or
    dolphins that are still legal to harvest

13
Detecting the Sale of Meat from Protected Whales
  • In the early 1990s Baker and Palumbi began
    purchasing whale products from Asian markets
    for mtDNA analysis
  • By comparing unknown samples against a reference
    database of cetacean mtDNA sequences, they were
    able to identify species and sometimes geographic
    source of each sample

14
(No Transcript)
15
Detecting the Sale of Meat from Protected Whales
  • By 1999, 954 samples of whale meat had been
    purchased in Japan and Korea
  • 773 were from whales, 9 were from protected
    whale species (including blue, humpback, fin and
    Brydes whales)
  • Samples that were not from whales included
    dolphins, porpoises, sheep and horses
  • Demands that whales be genetically typed to
    monitor distribution

16
Web-Based Molecular Identification of Whales,
Dolphins Porpoiseshttp//www.cebl.auckland.ac.n
z9000/
Data Entry
  • GAAAATATATATTGTACAATAACCACAAGGCCACAGTATTATGTCCGTAT
    TAAAAATAAC TTATTTTATTGCATACTGTTATGTAACTTGTGCATGTAT
    GTACTCCCACATAACCCATAG TAGTTAGTATTCCCCTGTGAATATGTAT
    ATGTACACATACTATGTATAATTGTGCATTCA
    ATTATCTTCACTACGGAAGTTAAAGCCCGTATTAAATTTTATTAATTTTA
    CATATTACAT AATATTTATTAATAGTACAATAGTACATGTTCTTATGCA
    TCCTCAGGTCATTCTAGACGG AATGACTCTTATGGCCGCTCCATTAGAT
    CACGAGCTTAATCAGCATGCCGCGTGAAACCA
    GCAACCCGCTCGGCAGGGATCCCTCTTCTCGCACCGGGCCCATCAATCGT
    GGGGGTAGCT ATTTAATGATCTTTATAAGACATCTGGTTCTTACTTCAG
    GACCATATTAACTTAAAATCG

17
Grouping All Cetaceans Vs3.1, Region mtDNA
control Region (D-Loop)
18
Solving Wildlife Crime
  • Lorenzini, R. DNA forensics and the poaching of
    wildlife in Italy A case study. Forensic Science
    International 153218-221.

Wild Boar (Sus scrofa)
19
mtDNA Cytochrome b
  • The cytochrome b gene is the most widely used
    gene for phylogenetic work
  • Although it evolves slowly in terms of
    non-synonymous substitutions, the rate of
    evolution in silent positions is relatively fast
  • Cytochrome b is conserved enough for clarifying
    deeper phylogenetic relationships

20
Cytochrome b
  • PCR amplified 307 bp fragment of mtDNA cytchrome
    b
  • Restriction digested Hsp92II, Tsp509I, HinfI
  • Restriction morphs of bloodstains compared to
    reference samples of cattle, sheep, swine/wild
    boar, goat, chicken, roe deer, red deer, fallow
    deer, brown bear, rabbit, wolf/dog, cat,
    porcupine, and fox
  • Species-specific separation except for domestic
    pig and wild boar

21
Restriction of mtDNA D-loopSeparates Pig from
Wild Boar all 3 bloodstains from knife matched
poached animal
Wild Boar
Wild Boar
Pig
Pig
531 bp mtDNA D-loop
Restriction digest AvaII
22
12 Highly Polymorphic Microsatellites Profile
Matching Wild Boar Bood on Knife
23
  • Poached animal, 7 of 12 microsatellite loci were
    heterozygous, with a total of 18 alleles
  • Comparison of STR (short tandem repeat) patterns
    showed a 75-80 difference in total number of
    alleles
  • Probability that two individuals share the same
    12-loci genotype by chance is 1150,000
    acceptable for discriminating an individual
    within a population of a few hundred

Lane Microsatellite 1 Microsatellite 2
Microsatellite 3 . Band a
Band b Band a Band b Band a Band
b Knife 92 100 196
198 200 200 . 1
92 100 196 198
200 200 2 104
106 198 202 204
206 3 108 112
192 194 206 206
. . 30 94 98
196 200 188 190 .
24
Perpetrator was convicted of poaching and of
cruelty to animals based on the forensic evidence
25
Illegal Wildlife Trade
  • 1950s
  • Endangered by IUCN, Appendix I of CITES
    (Convention on International Trade of Endangered
    Species of Wild Fauna and Flora)
  • 1993 Chinese Government stopped trade of tiger
    parts (skin, bone, gall bladder, blood, meat) of
    wild or captive animals

26
Tiger Parts
  • Tiger SkinSit on skin to reduce fever.
  • Tiger Brain LotionMix with oil and rub on
    body to prevent acne and laziness.
  • Tiger Claw AmuletPut in your pocket for
    courage.
  • Tiger PenisAdd to soup and take at bedtime
    for virility
  • Tiger Hair Repellent
  • Burn to drive away centipedes.
  • Tiger Eyeball Pills
  • Take one a day to prevent convulsions.
  • Tiger Gallstone SalveCombine with honey and
    rub on abscesses as needed.
  • Tiger Bone PowderDrink with wine at bedtime
    for spring tonic.
  • Tiger Whiskers CharmUse as protection against
    bullets.
  • Tiger HeartTake three times a day at meals
    for courage and cunning.
  • Tiger Tailbone OintmentMix with soap and rub
    on skin rashes.

27
Illegal Wildlife Trade
  • On November 25, 2001 a citizen informed
    authorities that a member of a circus in Ningbo
    City was selling tiger meat, bone and other parts
    in a local marketplace
  • Police confiscated meat from the only buyer that
    could be located
  • The circus was known to have only one tiger on
    visiting the circus facilities the cage had been
    carefully cleaned and only a single unidentified
    hair could be collected

28
Illegal Wildlife TradeComparative material
  • Also available for study single plucked hair
    from a tiger at Hangzhou Zoo
  • Tiger fecal sample
  • Dried skin from tiger, leopard, clouded leopard,
    snow leopard, leopard cat, Asiatic golden cat,
    pala desert cat, muping tufted deer, and domestic
    cow

29
mtDNA Cytochrome b Sequence Data from Genbank
30
Amplification Patterns
Tiger
Non-Tiger
Con
M S H F CH
582 bp 408 bp
31
Results
  • D-loop analysis indicated that the meat and the
    hair from the tiger cage had identical sequences
    consistent with coming from the same individual
  • Under the wild animal protection laws of China,
    the carcasses of wild and captive animals listed
    on the CITES appendices must be disposed of by
    State authorities
  • If carcasses are traded, both buyers and sellers
    are liable for a fine and/or 1-7 years
    imprisonment

32
Development of New Forensic Methodologies
  • Shivji, M. et al. 2002. Genetic identification
    of pelagic shark body parts for conservation and
    trade monitoring. Conservation Biology
    161036-1047

Shark Finning is Really, Really Bad, But We Want
the Money Says Disney
33
North Atlantic Sharks
  • Dusky
  • Blue
  • Longfin Mako
  • Shortfin Mako
  • Porbeagle
  • Silky

34
Intergenic spacer between the 5.8S rDNA and 28S
rDNA
9-15 Sequence divergence
35
Amplification Results - 3 Primers
36
Amplification Results 8 Primers
About PowerShow.com