Participatory Approaches to Surveillance in West Africa PADSA Project Laboratory Training Component - PowerPoint PPT Presentation

1 / 34
About This Presentation
Title:

Participatory Approaches to Surveillance in West Africa PADSA Project Laboratory Training Component

Description:

Participatory Approaches to Surveillance in West Africa PADSA Project Laboratory Training Component – PowerPoint PPT presentation

Number of Views:74
Avg rating:3.0/5.0
Slides: 35
Provided by: hafezmoha
Category:

less

Transcript and Presenter's Notes

Title: Participatory Approaches to Surveillance in West Africa PADSA Project Laboratory Training Component


1
Participatory Approaches to Surveillance in West
Africa (PADSA) ProjectLaboratory Training
ComponentUSAID Project Partners meetingBamako
4-5 December, 2007
2
Objectives
  • To outline GTZ funded ILRI/AU-IBAR activities in
    AI Laboratory Diagnostic training Experiences,
    Gains and Gaps
  • To provide an outline of proposed Laboratory
    training within PADSA with emphasis on creation
    of a link between the PDS and Laboratory
    components for disease surveillance

3
Background
Joint AU-IBAR-ILRI Training course on
surveillance and diagnosis of avian influenza
virus for veterinary and medical laboratory staff
from African countries
4
Diagnosis of AI
  • Laboratory diagnosis plays a key role in the
    control of an AI outbreak
  • Prompt identification of an infected flock
    crucial for control and eradication
  • For LPAI, there is no die offs and laboratory
    diagnosis is the only means of diagnosing the
    infection.

5
Impacts
  • Enhance veterinary laboratory capacity in Africa
    and complement trainings initiated by FAO and WHO
  • Upgrade the laboratory facilities and equipments
    for effective diagnosis of HPAI
  • Create capacity for most countries to be able to
    better handle samples
  • Establish a network of African laboratories and
    coordination to improve their diagnostic capacity
    for successful surveillance in both animals and
    humans

6
Training content
  • Biosafety and sample collection, packaging,
    transportation and storage
  • Rapid direct antigen detection tests
  • Serological diagnosis
  • -ELISA-Haemagglutination test (HA)
  • -Haemagglutination-inhibition test (HI)
  • -Agar gel immunodiffusion test (AGID)
  • -Neuraminidase inhibition test (NI)
  • -Immuno-Fluorescence Assay (IFA)
  • -DIVA test to differentiate between
    vaccinated and infected animals (theory)
  • Virus Isolation and subtyping and pathotyping
  • Molecular Characterization

7
(No Transcript)
8
(No Transcript)
9
  • Achieved
  • 94 laboratory staff in 37 African countries
    provided with specialized knowledge in rapid
    detection of HPAI.
  • Training material produced and distributed.
  • In preparation and on going
  • Report and AI Laboratory Diagnostic Manual.
  • Africa AI Directory, Capacity and Network.
  • Way forward.

10
PPE
11
PPE for Veterinary use
12
Blood sampling
13
Necropsy and sampling
14
Public health
15
Packaging
16
Titration to establish haemagglutinin (HA) titre
Positive
Negative
17
ELISA
ELISA Reader
Optical Density ( OD )
18
Rapid Diagnostic Test Result Indicators
Directigen Fu A B
FLU OIA
QuickVue
ZstatFlu
19
IFA
20
Virus isolation
21
Molecular diagnosis
22
Bioinformatics
gtA1 DNA sequence GGNGGGCCCGCATCATGNAGAGTGGATGGATAT
GGCAACTGCAATACTAAGTGTCAAACTCCAATGGGTGCGATAAACTCCAG
CATGCCATTCCACAACATACACCCTCTCACCATTGGAGAATGCCCCAAAT
ATGTGAAATCAGATAGGTTGGTCCTTGCAACTGGACCCAGGAACGTCCCT
CAAAGAGAGACAAGAGGTCTATTTGGGGCTATAGCAGGCTTTATAGAGGG
AGGATGGCA
AA alignment Ref Viet INSSMPLHNI HPLTIGECPK
YVKSNRLVLA TGLRNSPQRE RRRKKRGLFG AIAGFIEGGW A1
(Test) INSSMPFHNI HPLTIGECPK YVKSDRLVLA
TGPRNVPQRE ----TRGLFG AIAGFIEGGW
Arbre phylogénétique obtenu en comparant nos
séquences A1 et A3 (Influenza aviaire faiblement
pathogène) avec les séquences de références H5N1
des clades 1 et 2
Phylogenetic tree
23
Lessons Learnt and way forward
1- Logistics 2- Coordination Harmonization 3-
Knowledge and gains 4- Way forward -Existing
capacities and needs for a generic capability and
for capacity building in policy
making -Coordination dealing with the
disconnect between lab and field -Research to
sustain capacity in AI etc
24
ILRI AI Activities
  • Afrychicks
  • DFID
  • GTZ Training
  • Indonesia
  • PADSA
  • Scoping Study

25
Proposed PADSA Laboratory training
26
THANK YOU
27
Trainees
  • 12 per training session,
  • 2 vet and 2 medical from each country,
  • Possibly from personnel who have already received
    Lab training on HPAI before (Thro FAO, WHO,
    USAID/ARC-OVI or ILRI/AU/IBAR)

28
Phase 1 Introductory training (Toward reducing
the disconnect between the lab and the field)
  • 10 days regional training (to coincide with the
    introductory regional PDS training)
  • 2 days of lectures to focus on laboratory
    concepts/techniques relating to AI surveillance
    and disease detection/collection of field samples
  • 3 days participating in sample collection in the
    field and packaging/shipping to designated
    laboratory
  • 3 days laboratory practice with collected samples
  • 2 days in-class discussions and laboratory
    plans for the field/lab practice
  • Lab and PDS personnel get together at some point
    in the training

29
Phase 1 Training content
  • Concepts/techniques related to AI surveillance
    and disease detection/collection of field samples
  • Bio-security, bio-containment, field sample
    collection, necropsy, packaging, shipping,
    transportation and storage
  • Rapid direct antigen detection tests
  • Serological diagnosis (HA, HI and AGID)
  • Molecular diagnostic (RNA isolation and RT-PCR)
  • Sequencing and Bioinformatics
  • Discussions and laboratory plans for the
    field/lab practice

30
Phase 2 1st Field and Lab practice in individual
country (Toward reducing the disconnect between
the lab and the field)
  • (To coincide with the regional PDS guided field
    practice)
  • 3 months in-country practice for field and
    laboratory diagnostic support.
  • The project to supply key materials/reagents to
    the countries.
  • Preparation of a laboratory report.
  • Participants visited once to evaluate progress
    and address any issues.
  • Lab and PDS personnel get together at some point
    in the training

31
Phase 3 Refresher training
  • (To coincide with the regional PDS refresher
    training)
  • 3 days including last day to draw up draft
    designs for the national Lab programs
  • Reporting and sharing of data with PADSA team
  • Lessons learnt, recommendations and way forward
  • Lab and PDS personnel get together at some point
    in the training

32
Trainers
  • ILRI scientist a trainer (identified by ILRI)
    from the region.
  • ILRI biometric unit involved in the planning
    stage of the experimental design for appropriate
    sampling and statistical analysis of data.
  • ILRI and IBAR are being creating a structure and
    a coordination mechanism to improve the control
    of AI. Regional coordinator of lab and field
    teams appointed by IBAR to fit as much as
    possible in the structure.

33
Guidelines
  • General monitoring Real-time PCR and serology
    targeting type A response (M gene) used.
  • In case of positivity H5, H7, H9 protocols (PCR
    and HI) applied.
  • PCR controls any H genes except H5, H7 and H9.
  • Should sudden death, high mortality in poultry
    occur during the study, differential diagnosis
    with NDV will be included.
  • Virus isolation in suitable Labs from positive
    samples to provide material for molecular
    characterisation.

34
Thank you
Write a Comment
User Comments (0)
About PowerShow.com