SWISSMODEL: Giving the proteome a third dimension' Torsten Schwede - PowerPoint PPT Presentation

Loading...

PPT – SWISSMODEL: Giving the proteome a third dimension' Torsten Schwede PowerPoint presentation | free to download - id: 12d87f-OThhM



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

SWISSMODEL: Giving the proteome a third dimension' Torsten Schwede

Description:

Institut Suisse de Bioinformatique. Istituto Svizzero di Bioinformatica ... The protein sequence contains all information needed to create a correctly ... – PowerPoint PPT presentation

Number of Views:153
Avg rating:3.0/5.0
Slides: 42
Provided by: Tors70
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: SWISSMODEL: Giving the proteome a third dimension' Torsten Schwede


1
SWISS-MODEL Giving the proteome a third
dimension.Torsten Schwede
Schweizerisches Institut für Bioinformatik Institu
t Suisse de Bioinformatique Istituto Svizzero di
Bioinformatica Swiss Institute of Bioinformatics
  • Fortaleza, Brasil
  • 1. August 2006
  • Torsten.Schwede_at_unibas.ch

2
Introduction
3
gggtctctcttgttagaccagatctgagcctgggagctctctggctaact
agggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaag
tagtgtgtgcccgtctgttgtgtgactctgatagctagagatcccttcag
accaaatttagtcagtgtgaaaaatctctagcagtggcgcctgaacaggg
acttgaaagcgaaagagaaaccagagaagctctctcgacgcaggactcgg
cttgctgaagcgcgcacggcaagaggcgaggggacggcgactggtgagta
cgccaaaattttgactagcggaggctagaaggagagagatgggtgcgaga
gcgtcgatattaagcgggggaggattagatagatgggaaaaaattcggtt
aaggccagggggaaagaaaaaatatagattaaaacatttagtatgggcaa
gcagggagctagaacgattcgcagtcaatcctggcctattagaaacatca
gaaggttgtagacaaatactgggacaactacaaccagcccttcagacagg
atcagaagaacttagatcattatataatacagtagcaaccctctattgtg
tgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagata
gaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctga
cacaggaaatagcagccaggtcagccaaaattaccccatagtgcagaaca
tccaggggcaaatggtacatcaggccatatcacctagaactttaaatgca
tgggtaaaagtagtagaagagaaggctttcagcccagaagtaatacccat
gttttcagcattatcagaaggagccaccccacaagatttaaacaccatgc
taaacacagtggggggacatcaagcagccatgcaaatgttaaaagagacc
atcaatgaggaagctgcagaatgggatagattgcatccagtgcatgcagg
gcctcatccaccaggccagatgagagaaccaaggggaagtgacatagcag
gaactactagtacccttcaggaacaaatagcatggatgacaaataatcca
cctatcccagtaggagaaatctataagagatggataatcctgggattaaa
taaaatagtaaggatgtatagccctaccagcattctggacataaaacaag
gaccaaaggaaccctttagagactatgtagaccggttctataagactcta
agagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacctt
gttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgg
gaccagcagctacactagaagaaatgatgacagcatgtcagggagtggga
ggacccggccataaagcaagagttttggcagaagcaatgagccaagtaac
aaattcagctaccataatgatgcagaaaggcaattttaggaaccaaagaa
aaattgttaagtgtttcaattgtggcaaagaagggcacatagccaaaaat
tgcagggcccctaggaaaaggggctgttggaaatgtggaaaggagggaca
ccaaatgaaagattgtactgagagacaggctaattttttagggaaaatct
ggccttcccacaggggaaggccagggaattttcctcagaacagactagag
ccaacagccccaccagccccaccagaagagagcttcaggtttggggaaga
gacaacaactccctctcagaagcaggagctgatagacaaggaactgtatc
cttcagcttccctcaaatcactctttggcaacgaccccttgtcacaataa
agataggggggcaactaaaggaagctctattagatacaggagcagatgat
acagtattagaagaaataaatttgccaggaagatggaaaccaaaaatgat
agggggaattggaggttttatcaaagtaagacagtatgatcaaatactcg
tagaaatctgtggacataaagctataggtacagtattagtaggacctaca
cctgtcaacataattggaagaaatctgttgactcagattggttgcacttt
aaattttcccattagtcctattgaaactgtaccagtaaaattaaagccag
gaatggatggcccaaaagttaaacaatggccattgacagaagaaaaaata
aaagcattagtagaaatctgtacagaaatggaaaaggaaggaaaaatttc
aaaaatcgggcctgaaaatccatataatactccagtatttgccataaaga
aaaaagacagtactaaatggagaaaattagtagatttcagagaacttaat
aagaaaactcaagacttctgggaagttcaattaggaataccacatcccgc
agggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcat
atttttcagttcccttagataaagaattcaggaagtacactgcatttacc
atacctagtataaacaatgagacaccagggattagatatcagtacaatgt
gcttccacagggatggaaaggatcaccagcaatattccaaagcagcatga
caaaaatcttagagccttttagaaaacaaaatccagacatagttatctat
caatacatggacgatttgtatgtaggatctgacttagaaatagggcagca
tagaacaaaaatagaggaactgagacaacatctgttgaagtggggattta
ccacaccagacaaaaaacatcagaaagaacctccattcctttggatgggt
tatgaactccatcctgataaatggacagtacagcctatagtgctgccaga
aaaggacagctggactgtcaatgacatacagaagttagtgggaaaattga
attgggcaagtcagatttacccagggattaaagtaaagcaattatgtaga
ctccttaggggaaccaaggcactaacagaagtaataccactaacaaaaga
agcagagctagaactggcagaaaacagggaaattctaaaagaaccagtac
atggagtgtattatgacccatcaaaagacttaatagcggaaatacagaag
caggggcaaggtcaatggacatatcaaatttatcaagagccatttaaaaa
tctgaaaacaggaaaatatgcaagaatgaggggtgcccacactaatgatg
taaaacaattaacagaggcagtgcaaaaaataaccacagaaagcatagta
atatggggaaagactcctaaatttaaactacccatacaaaaagaaacatg
ggaaacatggtggacagagtattggcaagccacctggattcctgagtggg
agtttgtcaatacccctcccttagtaaaattatggtaccagttagagaaa
gaacccataataggagcagaaactttctatgtagatggggcagctaacag
ggagactaaattaggaaaagcaggatatgttactaacaaagggagacaaa
aagttgtctccataactgacacaacaaatcagaagactgagttacaagca
attcttctagcattacaggattctggattagaagtaaacatagtaacaga
ctcacaatatgcattaggaatcattcaagcacaaccagataaaagtgaat
cagagatagtcagtcaaataatagagcagttaataaaaaaagaaaaggtc
tacctgacatgggtaccagcgcacaaaggaattggaggaaatgaacaagt
agataaattagtcagtactggaatcaggaaagtactctttttagatggaa
tagataaagcccaagaagaacatgaaaaatatcacagtaattggagggca
atggctagtgattttaacctgccacctgtggtagcaaaagagatagtagc
cagctgtgataaatgtcagctaaaaggagaagccatgcatggacaagtag
actgtagtccaggaatatggcaactagattgtacacatttagaaggaaaa
attatcctggtagcagttcatgtagccagtggatatatagaagcagaagt
tattccagcagaaacagggcaggaaacagcatactttctcttaaaattag
caggaagatggccagtaaaaacagtacatacagacaatggcagcaatttc
accagtactacagttaaggccgcctgttggtgggcaggaatcaagcagga
atttggcattccctacaatccccaaagtcaaggagtagtagaatctataa
ataaagaattaaagaaagttataggacagataagagatcaggctgaacat
cttaagacagcagtacaaatggcagtattcatccacaattttaaaagaaa
aggggggattggggggtacagtgcaggggaaagaatagtagacataatag
caacagacatacaaactaaagaactacaaaaacaaattacaaaaattcaa
aattttcgggtttattacagggacagcagagatccactttggaaaggacc
agcaaagcttctctggaaaggtgaaggggcagtagtaatacaagataata
gtgacataaaagtagtgccaagaagaaaagcaaagatcattagggattat
ggaaaacagatggcaggtgatgattgtgtggcaagtagacaggatgagga
ttagaacatggaaaagtttagtaaaacaccatatgtatgtttcaaggaaa
gctaagggatggttttatagacatcactatgaaagtactcatccgagaat
aagttcagaagtacacatcccactagggaatgcaaaattggtaataacaa
catattggggtctacatacaggagaaagagactggcatttgggtcaagga
gtctccatagaattgaggaaaaggagatatagcacacaattagaccctaa
cctagcagaccaactaattcatctgcattactttgattgtttttcagaat
ctgctataagaaatgccatattaggacatatagttagccctaggtgtgaa
tatcaagcaggacataacaaggtaggatctctacagtacttggcactaac
agcattagtaagaccaagaaaaaagataaagccacctttgcctagtgtta
caaaactgacagaggatagatggaacaagccccagaagaccaagggccac
aaagggaaccatacaatgaatggacactagaacttttagaggagctcaag
aatgaagctgttagacattttcctaggatatggctccatagcttagggca
acatatctatgaaacttatggagatacttgggcaggagtggaagccataa
taagaattctgcaacaactgctgtttattcatttcagaattgggtgtcaa
catagcagaatagacattcttcgacgaaggagagcaagaaatggagccag
tagatcctagactagagccctggaagcatccaggaagtcagcctaggact
gcttgtaccaattgctattgtaaaaagtgttgctttcattgccaagtttg
tttcataacaaaaggcttaggcatctcctatggcaggaagaagcggagac
agcgacgaagagctcctcaagacagtcagactcatcaagtttctctatca
aagcagtaagtagtacatgtaatgcaatctttacaaatattagcagtagt
agcattagtagtagcagcaataatagcaatagttgtgtggtccatagtat
tcatagaatataggaaaataagaagacaaaacaaaatagaaaggttgatt
gatagaataatagaaagagcagaagacagtggcaatgagagtgacggaga
tcaggaagaattatcagcacttgtggaaatggggcacgatgctccttggg
atgttaatgatctgtaaagctgcagaaaatttgtgggtcacagtttatta
tggggtacctgtgtggaaagaagcaaccaccactctattttgtgcctcag
atgctaaagcgtatgatacagaggtacataatgtttgggccacacatgcc
tgtgtacccacagaccccaacccacaagaagtagaactgaagaatgtgac
agaaaattttaacatgtggaaaaataacatggtagaccaaatgcatgagg
atataattagtttatgggatcaaagcctaaagccatgtgtaaaattaacc
ccactctgtgttactttaaattgcactgattatgggaatgatactaacac
caataatagtagtgctactaaccccactagtagtagcgggggaatggagg
ggagaggagaaataaaaaattgctctttcaatatcaccagaagcataaga
gataaagtgaagaaagaatatgcacttttttatagtcttgatgtaatacc
aataaaagatgataatactagctataggttgagaagttgtaacacctcag
tcattacacaggcctgtccaaaggtatcctttgaaccaattcccatacat
tattgtgccccggctggttttgcgattctaaagtgtaatgataaaaagtt
caatggaaaaggaccatgtacaaatgtcagcacagtacaatgtacacatg
gaattaggccagtagtatcaactcaactgctgttaaatggcagtctagca
gaagaagaggtagtaattagatcagacaatttctcggacaatgctaaagt
cataatagtacatctgaatgaatctgtagaaattaattgtacaagactca
acaacattacaaggagaagtatacatgtaggacatgtaggaccaggcaga
gcaatttatacaacaggaataataggaaaaataagacaagcacattgtaa
cattagtagagcaaaatggaataacactttaaaacagatagttacaaaat
taagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
ggggacccagaaattgtaatgcacagttttaattgtggaggggaattttt
ctactgtaattcaacacaactgtttaacagtacttggaatggtactgcat
ggtcaaataacactgaaggaaatgaaaatgacacaatcacactcccatgc
agaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgta
tgcacctcccatcagaggacaaattagatgttcatcaaatattacagggc
tgatattaacaagagatggtggtattaaccagaccaacaccaccgagatt
ttcaggcctggaggaggagatatgaaggacaattggagaagtgaattata
taaatataaagtagtaaaaattgaaccattaggagtagcacccaccaagg
caaagagaagagtggtgcaaagagaaaaaagagcagtgggaataatagga
gctatgctccttgggttcttgggagcagcaggaagcactatgggcgcagc
gtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgc
aacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttg
cacctcacagtctggggcatcaagcagctccaagcaagagtcctggctgt
ggaaagatacctaagggatcaacagctcctggggttttggggttgctctg
gaaaactcatttgcaccactgctgtgccttggaatactagttggagtaat
aaatctctgagtcagatttgggataacatgacctggatgcagtgggaaag
ggaaattgataattacacaagcttaatatacaacttaattgaagaatcgc
aaaaccaacaagaaaagaatgaacaagagttattggaattagataactgg
gcaagtttgtggaattggtttagcataacaaattggctgtggtatataaa
aatattcataatgatagtaggaggcttggtaggtttaagaatagttttta
ctgtactttctatagtaaatagagttaggcagggatactcaccattgtcg
tttcagacgcgcctcccagccaggaggggacccgacaggcccgaaggaat
cgaagaagaaggtggagagagagacagagacagatccggtcaattagtgg
atggattcttagcaattatctgggtcgacctgcggagcctgtgcctcttc
agctaccaccgcttgagagacttactcttgattgtaacgaggattgtgga
acttctgggacgcagggggtgggaagccctcaaatattggtggaatctcc
tacaatattggattcaggaactaaagaatagtgctgttagcttgctcaac
gccacagccatagcagtagctgagggaactgatagggttatagaagtatt
acaaagagcttgtagagctattctccacatacctagaagaataagacagg
gcttagaaagggctttgcaataagatgggtggtaagtggtcaaaaagtag
taaaattggatggcctactgtaagggaaagaatgagaagagctgagccag
cagcagatggggtgggagcagtatctcgagacctggaaaaacatggagca
atcacaagtagtaatacagcaactaacaatgctgattgtgcctggctaga
agcacaagaggaggaggaggtgggttttccagtcagacctcaggtacctt
taagaccaatgacttacaagggagcgttagatcttagccactttttaaaa
gaaaaggggggactggaagggctaatttggtcccagaaaagacaagacat
ccttgatttgtgggtccaccacacacaaggctacttccctgattggcaga
actacacaccagggccagggatcagatatccactgacctttggttggtgc
ttcaagctagtaccagttgagccagagaaggtagaagaggccaatgaagg
agagaacaacagattgttacaccctgtgagcctgcatgggatggaggacc
cggagaaagaagtgttagtatggaggtttgacagccgcctagtactccgt
cacatggcccgagagctgcatccggagtactacaaggactgctgacactg
agctttctacaagggactttccgctggggactttccagggaggcgtggcc
tgggcgggactggggagtggcgagccctcagatgctgcatataagcagct
gctttttgcctgtactgggtctctcttgttagaccagatctgagcctggg
agctctctggctaactagggaacccactgcttaagcctcaataaagcttg
ccttgagtgcttca
4
gggtctctcttgttagaccagatctgagcctgggagctctctggctaact
agggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaag
tagtgtgtgcccgtctgttgtgtgactctgatagctagagatcccttcag
accaaatttagtcagtgtgaaaaatctctagcagtggcgcctgaacaggg
acttgaaagcgaaagagaaaccagagaagctctctcgacgcaggactcgg
cttgctgaagcgcgcacggcaagaggcgaggggacggcgactggtgagta
cgccaaaattttgactagcggaggctagaaggagagagatgggtgcgaga
gcgtcgatattaagcgggggaggattagatagatgggaaaaaattcggtt
aaggccagggggaaagaaaaaatatagattaaaacatttagtatgggcaa
gcagggagctagaacgattcgcagtcaatcctggcctattagaaacatca
gaaggttgtagacaaatactgggacaactacaaccagcccttcagacagg
atcagaagaacttagatcattatataatacagtagcaaccctctattgtg
tgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagata
gaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctga
cacaggaaatagcagccaggtcagccaaaattaccccatagtgcagaaca
tccaggggcaaatggtacatcaggccatatcacctagaactttaaatgca
tgggtaaaagtagtagaagagaaggctttcagcccagaagtaatacccat
gttttcagcattatcagaaggagccaccccacaagatttaaacaccatgc
taaacacagtggggggacatcaagcagccatgcaaatgttaaaagagacc
atcaatgaggaagctgcagaatgggatagattgcatccagtgcatgcagg
gcctcatccaccaggccagatgagagaaccaaggggaagtgacatagcag
gaactactagtacccttcaggaacaaatagcatggatgacaaataatcca
cctatcccagtaggagaaatctataagagatggataatcctgggattaaa
taaaatagtaaggatgtatagccctaccagcattctggacataaaacaag
gaccaaaggaaccctttagagactatgtagaccggttctataagactcta
agagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacctt
gttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgg
gaccagcagctacactagaagaaatgatgacagcatgtcagggagtggga
ggacccggccataaagcaagagttttggcagaagcaatgagccaagtaac
aaattcagctaccataatgatgcagaaaggcaattttaggaaccaaagaa
aaattgttaagtgtttcaattgtggcaaagaagggcacatagccaaaaat
tgcagggcccctaggaaaaggggctgttggaaatgtggaaaggagggaca
ccaaatgaaagattgtactgagagacaggctaattttttagggaaaatct
ggccttcccacaggggaaggccagggaattttcctcagaacagactagag
ccaacagccccaccagccccaccagaagagagcttcaggtttggggaaga
gacaacaactccctctcagaagcaggagctgatagacaaggaactgtatc
cttcagcttccctcaaatcactctttggcaacgaccccttgtcacaataa
agataggggggcaactaaaggaagctctattagatacaggagcagatgat
acagtattagaagaaataaatttgccaggaagatggaaaccaaaaatgat
agggggaattggaggttttatcaaagtaagacagtatgatcaaatactcg
tagaaatctgtggacataaagctataggtacagtattagtaggacctaca
cctgtcaacataattggaagaaatctgttgactcagattggttgcacttt
aaattttcccattagtcctattgaaactgtaccagtaaaattaaagccag
gaatggatggcccaaaagttaaacaatggccattgacagaagaaaaaata
aaagcattagtagaaatctgtacagaaatggaaaaggaaggaaaaatttc
aaaaatcgggcctgaaaatccatataatactccagtatttgccataaaga
aaaaagacagtactaaatggagaaaattagtagatttcagagaacttaat
aagaaaactcaagacttctgggaagttcaattaggaataccacatcccgc
agggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcat
atttttcagttcccttagataaagaattcaggaagtacactgcatttacc
atacctagtataaacaatgagacaccagggattagatatcagtacaatgt
gcttccacagggatggaaaggatcaccagcaatattccaaagcagcatga
caaaaatcttagagccttttagaaaacaaaatccagacatagttatctat
caatacatggacgatttgtatgtaggatctgacttagaaatagggcagca
tagaacaaaaatagaggaactgagacaacatctgttgaagtggggattta
ccacaccagacaaaaaacatcagaaagaacctccattcctttggatgggt
tatgaactccatcctgataaatggacagtacagcctatagtgctgccaga
aaaggacagctggactgtcaatgacatacagaagttagtgggaaaattga
attgggcaagtcagatttacccagggattaaagtaaagcaattatgtaga
ctccttaggggaaccaaggcactaacagaagtaataccactaacaaaaga
agcagagctagaactggcagaaaacagggaaattctaaaagaaccagtac
atggagtgtattatgacccatcaaaagacttaatagcggaaatacagaag
caggggcaaggtcaatggacatatcaaatttatcaagagccatttaaaaa
tctgaaaacaggaaaatatgcaagaatgaggggtgcccacactaatgatg
taaaacaattaacagaggcagtgcaaaaaataaccacagaaagcatagta
atatggggaaagactcctaaatttaaactacccatacaaaaagaaacatg
ggaaacatggtggacagagtattggcaagccacctggattcctgagtggg
agtttgtcaatacccctcccttagtaaaattatggtaccagttagagaaa
gaacccataataggagcagaaactttctatgtagatggggcagctaacag
ggagactaaattaggaaaagcaggatatgttactaacaaagggagacaaa
aagttgtctccataactgacacaacaaatcagaagactgagttacaagca
attcttctagcattacaggattctggattagaagtaaacatagtaacaga
ctcacaatatgcattaggaatcattcaagcacaaccagataaaagtgaat
cagagatagtcagtcaaataatagagcagttaataaaaaaagaaaaggtc
tacctgacatgggtaccagcgcacaaaggaattggaggaaatgaacaagt
agataaattagtcagtactggaatcaggaaagtactctttttagatggaa
tagataaagcccaagaagaacatgaaaaatatcacagtaattggagggca
atggctagtgattttaacctgccacctgtggtagcaaaagagatagtagc
cagctgtgataaatgtcagctaaaaggagaagccatgcatggacaagtag
actgtagtccaggaatatggcaactagattgtacacatttagaaggaaaa
attatcctggtagcagttcatgtagccagtggatatatagaagcagaagt
tattccagcagaaacagggcaggaaacagcatactttctcttaaaattag
caggaagatggccagtaaaaacagtacatacagacaatggcagcaatttc
accagtactacagttaaggccgcctgttggtgggcaggaatcaagcagga
atttggcattccctacaatccccaaagtcaaggagtagtagaatctataa
ataaagaattaaagaaagttataggacagataagagatcaggctgaacat
cttaagacagcagtacaaatggcagtattcatccacaattttaaaagaaa
aggggggattggggggtacagtgcaggggaaagaatagtagacataatag
caacagacatacaaactaaagaactacaaaaacaaattacaaaaattcaa
aattttcgggtttattacagggacagcagagatccactttggaaaggacc
agcaaagcttctctggaaaggtgaaggggcagtagtaatacaagataata
gtgacataaaagtagtgccaagaagaaaagcaaagatcattagggattat
ggaaaacagatggcaggtgatgattgtgtggcaagtagacaggatgagga
ttagaacatggaaaagtttagtaaaacaccatatgtatgtttcaaggaaa
gctaagggatggttttatagacatcactatgaaagtactcatccgagaat
aagttcagaagtacacatcccactagggaatgcaaaattggtaataacaa
catattggggtctacatacaggagaaagagactggcatttgggtcaagga
gtctccatagaattgaggaaaaggagatatagcacacaattagaccctaa
cctagcagaccaactaattcatctgcattactttgattgtttttcagaat
ctgctataagaaatgccatattaggacatatagttagccctaggtgtgaa
tatcaagcaggacataacaaggtaggatctctacagtacttggcactaac
agcattagtaagaccaagaaaaaagataaagccacctttgcctagtgtta
caaaactgacagaggatagatggaacaagccccagaagaccaagggccac
aaagggaaccatacaatgaatggacactagaacttttagaggagctcaag
aatgaagctgttagacattttcctaggatatggctccatagcttagggca
acatatctatgaaacttatggagatacttgggcaggagtggaagccataa
taagaattctgcaacaactgctgtttattcatttcagaattgggtgtcaa
catagcagaatagacattcttcgacgaaggagagcaagaaatggagccag
tagatcctagactagagccctggaagcatccaggaagtcagcctaggact
gcttgtaccaattgctattgtaaaaagtgttgctttcattgccaagtttg
tttcataacaaaaggcttaggcatctcctatggcaggaagaagcggagac
agcgacgaagagctcctcaagacagtcagactcatcaagtttctctatca
aagcagtaagtagtacatgtaatgcaatctttacaaatattagcagtagt
agcattagtagtagcagcaataatagcaatagttgtgtggtccatagtat
tcatagaatataggaaaataagaagacaaaacaaaatagaaaggttgatt
gatagaataatagaaagagcagaagacagtggcaatgagagtgacggaga
tcaggaagaattatcagcacttgtggaaatggggcacgatgctccttggg
atgttaatgatctgtaaagctgcagaaaatttgtgggtcacagtttatta
tggggtacctgtgtggaaagaagcaaccaccactctattttgtgcctcag
atgctaaagcgtatgatacagaggtacataatgtttgggccacacatgcc
tgtgtacccacagaccccaacccacaagaagtagaactgaagaatgtgac
agaaaattttaacatgtggaaaaataacatggtagaccaaatgcatgagg
atataattagtttatgggatcaaagcctaaagccatgtgtaaaattaacc
ccactctgtgttactttaaattgcactgattatgggaatgatactaacac
caataatagtagtgctactaaccccactagtagtagcgggggaatggagg
ggagaggagaaataaaaaattgctctttcaatatcaccagaagcataaga
gataaagtgaagaaagaatatgcacttttttatagtcttgatgtaatacc
aataaaagatgataatactagctataggttgagaagttgtaacacctcag
tcattacacaggcctgtccaaaggtatcctttgaaccaattcccatacat
tattgtgccccggctggttttgcgattctaaagtgtaatgataaaaagtt
caatggaaaaggaccatgtacaaatgtcagcacagtacaatgtacacatg
gaattaggccagtagtatcaactcaactgctgttaaatggcagtctagca
gaagaagaggtagtaattagatcagacaatttctcggacaatgctaaagt
cataatagtacatctgaatgaatctgtagaaattaattgtacaagactca
acaacattacaaggagaagtatacatgtaggacatgtaggaccaggcaga
gcaatttatacaacaggaataataggaaaaataagacaagcacattgtaa
cattagtagagcaaaatggaataacactttaaaacagatagttacaaaat
taagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
ggggacccagaaattgtaatgcacagttttaattgtggaggggaattttt
ctactgtaattcaacacaactgtttaacagtacttggaatggtactgcat
ggtcaaataacactgaaggaaatgaaaatgacacaatcacactcccatgc
agaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgta
tgcacctcccatcagaggacaaattagatgttcatcaaatattacagggc
tgatattaacaagagatggtggtattaaccagaccaacaccaccgagatt
ttcaggcctggaggaggagatatgaaggacaattggagaagtgaattata
taaatataaagtagtaaaaattgaaccattaggagtagcacccaccaagg
caaagagaagagtggtgcaaagagaaaaaagagcagtgggaataatagga
gctatgctccttgggttcttgggagcagcaggaagcactatgggcgcagc
gtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgc
aacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttg
cacctcacagtctggggcatcaagcagctccaagcaagagtcctggctgt
ggaaagatacctaagggatcaacagctcctggggttttggggttgctctg
gaaaactcatttgcaccactgctgtgccttggaatactagttggagtaat
aaatctctgagtcagatttgggataacatgacctggatgcagtgggaaag
ggaaattgataattacacaagcttaatatacaacttaattgaagaatcgc
aaaaccaacaagaaaagaatgaacaagagttattggaattagataactgg
gcaagtttgtggaattggtttagcataacaaattggctgtggtatataaa
aatattcataatgatagtaggaggcttggtaggtttaagaatagttttta
ctgtactttctatagtaaatagagttaggcagggatactcaccattgtcg
tttcagacgcgcctcccagccaggaggggacccgacaggcccgaaggaat
cgaagaagaaggtggagagagagacagagacagatccggtcaattagtgg
atggattcttagcaattatctgggtcgacctgcggagcctgtgcctcttc
agctaccaccgcttgagagacttactcttgattgtaacgaggattgtgga
acttctgggacgcagggggtgggaagccctcaaatattggtggaatctcc
tacaatattggattcaggaactaaagaatagtgctgttagcttgctcaac
gccacagccatagcagtagctgagggaactgatagggttatagaagtatt
acaaagagcttgtagagctattctccacatacctagaagaataagacagg
gcttagaaagggctttgcaataagatgggtggtaagtggtcaaaaagtag
taaaattggatggcctactgtaagggaaagaatgagaagagctgagccag
cagcagatggggtgggagcagtatctcgagacctggaaaaacatggagca
atcacaagtagtaatacagcaactaacaatgctgattgtgcctggctaga
agcacaagaggaggaggaggtgggttttccagtcagacctcaggtacctt
taagaccaatgacttacaagggagcgttagatcttagccactttttaaaa
gaaaaggggggactggaagggctaatttggtcccagaaaagacaagacat
ccttgatttgtgggtccaccacacacaaggctacttccctgattggcaga
actacacaccagggccagggatcagatatccactgacctttggttggtgc
ttcaagctagtaccagttgagccagagaaggtagaagaggccaatgaagg
agagaacaacagattgttacaccctgtgagcctgcatgggatggaggacc
cggagaaagaagtgttagtatggaggtttgacagccgcctagtactccgt
cacatggcccgagagctgcatccggagtactacaaggactgctgacactg
agctttctacaagggactttccgctggggactttccagggaggcgtggcc
tgggcgggactggggagtggcgagccctcagatgctgcatataagcagct
gctttttgcctgtactgggtctctcttgttagaccagatctgagcctggg
agctctctggctaactagggaacccactgcttaagcctcaataaagcttg
ccttgagtgcttca
We need to understand structure and function of
proteins.
5
Public Database content
  • Experimentally determined protein structures (PDB)

37'874
1588
214
(Source PDB)
6
Public Database content
  • Experimentally known protein structures (PDB)

7
Public Database content
  • Annotated Protein Sequences Swiss-Prot

8
Public Database content
  • Protein Sequences translated from DNA trEMBL
  • No experimental
  • structure for mostprotein sequences

(Sources PDB, EBI, SIB)
9
Protein Folding
  • Many proteins fold spontaneously to their native
    structure
  • Protein folding is relatively fast (nsec sec)
  • Chaperones speed up folding, but do not alter the
    structure

The protein sequence contains all information
needed to create a correctly folded protein
(Anfinsen principle).
10
Comparative protein structure modelling
11
(No Transcript)
12
René Magritte. The Human Condition. 1935. Oil on
canvas.
13
Comparative Protein Structure Modelling
Known Structures(Templates)
Target Sequence
Structure Evaluation Assessment
HomologyModel(s)
14
Comparative Protein Structure Modelling
  • Why do we need automated expert systems for
    comparative protein modelling?
  • Too many new sequences, too many new structures
  • Objectivity and Reproducibility remove
    individual human bias predictable reliability of
    results
  • Improve methods and algorithms
  • Easy access for end users

15
User emails ...
16
SWISS-MODEL Server
How to automate protein modeling?
3D - Model requests 2005 gt148000 requests
400 models per work day one model every 4
minutes
1. M.C. Peitsch and C.V. Jongeneel (1993) Int.
Immunol. 5, 233-238 2. Peitsch MC (1995)
Bio/Technology 13658-660. 3. Guex N and Peitsch
MC (1997) Electrophoresis 182714-2723. 4.
Schwede T, Kopp J, Guex N, Peitsch MC (2003)
Nucleic Acids Research 31, 3381-3385.
17
SWISS-MODEL Workspace
Arnold K, Bordoli L, Kopp J, Schwede T (2006)
Bioinformatics 22,195-201.
18
SWISS-MODEL Template Library
Arnold K, Bordoli L, Kopp J, Schwede T (2006)
Bioinformatics 22,195-201.
19
DeepView - Swiss-PdbViewer
Collaboration with Nicolas Guex (GSK)
http//www.expasy.org/spdbv/
Guex N and Peitsch MC (1997) Electrophoresis
182714-2723.
20
SWISS-MODEL Repository
PDB/SMTL
Template updates
SwissProt / TrEMBL
UpdateModel?
Sequence updates
SWISS-MODELServer
SWISS-MODELRepository Oracle Control DB
SWISS-MODELRepository mySQL DB / WEB
Quality ok?
Kopp J, and Schwede T (2004). Nucleic Acids
Research 32 , D230-D234.
21
SWISS-MODEL Repository
Kopp J, and Schwede T (2006). Nucleic Acids
Research 34 , D315-D318.
22
SWISS-MODEL Repository
Kopp J, and Schwede T (2006). Nucleic Acids
Research 34 , D315-D318.
23
SWISS-MODEL Repository
Kopp J, and Schwede T (2006). Nucleic Acids
Research 34 , D315-D318.
24
Evaluation of Model Accuracy
25
Evaluation of model accuracy
... a model must be wrong, in some respects --
else it would be the thing itself. The trick is
to see ... where it is right.
Henry A. Bent "Uses (and Abuses) of Models in
Teaching Chemistry," J. Chem. Ed. 1984 61, 774.
SIV Model based on 1BL3 (C) HIV-1 Integrase
core domain Experimental structure 1C6V (C) SIV
Integrase core domain Seq. Identity 61
26
Evaluation of Model Accuracy
27
Evaluation of automated protein structure
prediction
Weekly PDB released target sequences MNIFEMLRID
EGLRLKIYKD TEGYYTIGIG HLLTKSPSLN AAKSELDKAI
GRNCNGVITK
EVA Server
Prediction Servers
1
MNIFEMLRID EGLRLKIYKD TEGYYTIGIG HLLTKSPSLN
AAKSELDKAI GRNCNGVITK
e.g. SWISS-MODEL
(Koh et al. (2003) Nucleic Acids Res. 31, 3311-5 )
28
Evaluation of Automated protein structure
prediction
  • Evaluation of 246 weekly PDB releases (20'108
    models)

Data source EVA-CM http//cubic.bioc.columbia.e
du/eva/
29
Evaluation of Automated protein structure
prediction
  • Evaluation of 246 weekly PDB releases (20'108
    models)

SWISS-MODEL has the lowest cumulative average
global RMSD of the servers in the comparison.
Data source EVA-CM http//cubic.bioc.columbia.e
du/eva/
30
Evaluation of Automated protein structure
prediction
  • Evaluation of 246 weekly PDB releases (20'108
    models)

The lower RMSD of SWISS-MODEL is related to a
lower coverage in sequence space.
Data source EVA-CM http//cubic.bioc.columbia.e
du/eva/
31
Evaluation of Model Accuracy
Data source EVA-CM http//cubic.bioc.columbia.e
du/eva/
32
Applications of comparative modelling
Possible applications of comparative models
depend on the expected accuracy.
(Kopp Schwede, Pharmacogenomics, 2004 )
33
Application Examples
34
Applications
  • Structural Assessment of Sequence Variations
  • Comparative modeling allows for detailed
    structure-based assessment of sequence
    variations. Mutations, ns-cSNPs, alternative
    splicing, iso-forms and other sequence variations
    may be responsible for functional variations and
    involved in rare inherited diseases, individual
    differences in drug response, and susceptibility
    for common diseases.

(Wattenhofer, et. al. J. Mol. Med. 2002 )
Rational design of Functional Mutations Comparativ
e modeling allows for designing specific site
directed mutations to study functional role of
individual residues or structural
features. Example Design of partial and complete
deletion mutations of the plug domain of Sec61p
to study its functional role. Conclusion The
plug domain of Sec61p is non-essential, but
influences topogenesis and Sec61 assembly.
Junne, Schwede, Goder Spiess (2006) Molecular
Cell, in press
35
Application Models in structure based drug
discovery
  • Can homology models be used in structure based
    drug discovery when no experimental protein
    structures are available?
  • How do errors and inaccuracies of the homology
    models affect the subsequent molecular modeling
    of protein-ligand interaction?
  • Estimating relative ligand binding free energies
    using MD-GBSA
  • 500 ps MD Simulation for conformational sampling
    (MM-GBSA)
  • ?Gbind lt ?Evacuo gt lt ?Gdesolv gt - lt T?S gt
  • Collaboration with Markus Meuwly (Computational
    Chemistry, Uni Basel) Vincent Zoete (SIB
    Lausanne)

Thorsteinsdottir HB, Schwede T, Zoete V, and
Meuwly M (2006). Proteins (in press).
36
Application Models in structure based drug
discovery
  • Example 16 HIV-I protease inhibitor complexes
  • Validation Correlation between experimental and
    calculated relative binding free energies
  • Application Systematic analysis of the influence
    of typical modeling errors.

Thorsteinsdottir HB, Schwede T, Zoete V, and
Meuwly M (2006). Proteins (in press).
37
Summary and Outlook
38
Summary and outlook
  • Today's Bioinformatics view is still largely
    (DNA)- sequence centric. Understanding
    macromolecular function in detail requires
    knowledge of its 3D structure.
  • 10 years ago, for the vast the majority of
    proteins no information about its 3-dimensional
    structure was available.
  • Today, structural genomics and comparative
    modelling are complementing each other in
    exploring the structural space. Within the next
    decade, 3D information will become available for
    the majority of all globular protein domains.
  • gt 90 of this structural information will be
    based on comparative models.
  • SWISS-MODEL aims at providing a fully integrated
    protein-centric view of all available structural
    information on a given protein.

39
SWISS-MODEL
SWISS-MODEL is accessible freely at Expasy
  • SWISS-MODEL Server
  • http//swissmodel.expasy.org
  • DeepView (Swiss-PdbViewer)
  • http//www.expasy.org/spdbv/
  • SWISS-MODEL Workspace
  • http//swissmodel.expasy.org/workspace/
  • SWISS-MODEL Repository
  • http//swissmodel.expasy.org/repository/

40
Acknowledgements
Biozentrum SIB Basel Hólmfríður B.
Þorsteinsdóttir Lorenza Bordoli Jürgen
Kopp Michael Podvinec James Battey Konstantin
Arnold Rainer Pöhlmann Roger Jenni Robert
Gaisbauer Mihaela Zavolan Martin
Spiess University of Basel Markus
Meuwly Novartis Basel Manuel Peitsch
SIB - Swiss Institute of Bioinformatics (LS GE)
Amos Bairoch Elisabeth Gasteiger Ernest
Feytmans Olivier Michielin Vincent Zoete Victor
Jongeneel Jacques Rougemont NCI Frederick Jack
Collins Karol Miaskiweicz Robert W. Lebherz GSK
RD Nicolas Guex Alexander Diemand
EBI - European Bioinformatics Institute Kim
Henrick Rolf Apweiler Nicola Moulder Ujjwal
Das Pontificia Universidad Católica de Chile
Francisco Melo
Financial support
41
Acknowledgements
Biozentrum SIB Basel Hólmfríður B.
Þorsteinsdóttir Lorenza Bordoli Jürgen
Kopp Michael Podvinec James Battey Konstantin
Arnold Rainer Pöhlmann Roger Jenni Robert
Gaisbauer Mihaela Zavolan Martin
Spiess University of Basel Markus
Meuwly Novartis Basel Manuel Peitsch
SIB - Swiss Institute of Bioinformatics (LS GE)
Amos Bairoch Elisabeth Gasteiger Ernest
Feytmans Olivier Michielin Vincent Zoete Victor
Jongeneel Jacques Rougemont NCI Frederick Jack
Collins Karol Miaskiweicz Robert W. Lebherz GSK
RD Nicolas Guex Alexander Diemand
EBI - European Bioinformatics Institute Kim
Henrick Rolf Apweiler Nicola Moulder Ujjwal
Das Pontificia Universidad Católica de Chile
Francisco Melo
Financial support
About PowerShow.com