DNA Forensics

1
DNA Forensics
How DNA is used Ethical Issues
By Daniel DiCenzo
2
What is DNA?

• DNA - Deoxyribonucleic acid
• DNA is the blueprint for the design of our bodies
• Consists of certain base pairs that form specific
  sequences
• These sequences can code for specific amino acids
• These amino acids combine
• to form proteins
• The proteins together make
• our entire body
• Everyones DNA is unique
• DNA holds all of the information
• needed to make living things

3
What is DNA used to do?

• Code for amino acids in our bodies
• Act as a bar code that identifies who we are (DNA
  Fingerprint)
• DNA can be analyzed and compared to other DNA
• Comparing DNA can be used for many purposes
• To match and analyze peoples DNA, scientists
  must perform special tests

4
What Are These Tests

• There are many ways to process DNA
• Polymerase Chain Reaction (PCR)
• Restriction Fragment Length Polymorphism (RFLP)
• Short Tandem Repeat (STR)
• Mitochondrial DNA (mtDNA)
• DNA is taken from mitochondrion instead of
  nucleus

5
Polymerase Chain Reaction

• To put it simply PCRs are used to amplify a
  certain piece of DNA
• The initial piece of DNA is separated into two
  strands
• RNA primer is attached at specific spot on DNA
• DNA polymerase adds base pairs to both single
  stranded DNA
• The product is two identical pieces of double
  stranded DNA
• This process is repeated many times to achieve a
  large amount of DNA
• The amount of DNA produced after every cycle
  however increases exponentially
• This process allows a large amount of DNA to be
  produced from only a minute sample collected

http//campus.queens.edu/faculty/jannr/Genetics/im
ages/dnatech/FG12_11cPCR2.JPG
6
Restriction Fragment Length Polymorphism

• DNA is cut at specific points into fragments
• These fragments are then put in a gel
• Via gel electrophoresis the DNA fragments
  travel across the gel and stop at specific
  distances
• DNA can be compared to other DNA run through this
  same method
• This process however requires a large amount of
  DNA sample

http//www.ars.usda.gov/pandp/docs.htm?docid11828

7
Short Tandem Repeat

• Example of a tandem repeat
• TAAGCTAAGCTAAGCTAAGC
• In this tandem repeat TAAGC is repeated four
  times
• Every persons DNA contains these tandem reapeats
• These are inherited from your mother and your
  father
• These are used in identification because they are
  very unique in individuals
• Scientists analyze 13 loci in our DNA, this
  prevents any doubt that someone else shares these
  same genes
• If only 2 loci are analyzed the probability that
  someone else shares those genes are much higher
  which is not effective in identifying people
  using DNA

8
What are these fingerprints used for?

• DNA fingerprinting has many uses
• DNA fingerprinting has the ability to
• Prove someone is guilty/innocent of a crime
• Instantly find the culprit if they are in a DNA
  database
• Identify unknown bodies (old or new)
• Determine who the father of a baby is (Paternity
  Test)
• Find an organ match for a person
• Catch poachers hunting and selling the meat of
  endangered animals

9
Ethical Issues

• DNA identification Act (1998)
• Forces all those in Canada who have been
  convicted of a certain crime to be entered into
  the National DNA Databank (NDDB)
• This is also the case in the U.S.
• In 1998, all 50 states used their DNA databank,
  known as the National DNA Index System (NDIS)
• Having to be forced to provide DNA is a violation
  of human rights, even if you are a criminal
• Many believe in the future, everyones DNA will
  be on file
• All of our most valuable secrets are exposed
• Many believe this is an invasion of privacy
• Our DNA can predict how we will die, do we want
  that information?

10
Genetic Discrimination

• DNA holds secret to almost every weakness you
  have
• By allowing Insurance companies, employers,
  schools or banks access to any illness or flaw
  that you will, may or already have, you can be
  denied instantly
• Government can learn anything about you without
  your consent
• Those with Good DNA will be given better
  opportunities and success than those with Bad
  DNA
• This will lead to a new discrimination, not by
  race or religion, but by your DNA

11
Is DNA fingerprinting Reliable?

• People have come to believe that DNA evidence is
  indisputable in courtrooms (Too much faith in
  DNA)
• Human error is always a factor
• Contamination of evidence
• Labs are too pressured by police to give them the
  evidence they want to close the case
• With more strict regulations on the quality of
  labs and technological advances, human error will
  be greatly reduced
• Planting of evidence is a new problem
• This always leaves doubt into the reliability of
  DNA evidence
• Must look for probable cause in a case and not
  rely solely on DNA evidence

12
DNA Databanks

• There are approximately 200 000 people in the
  Canadian National DNA Databank
• To this date there have been 10 000 offender hits
  because of this system
• In the U.S., 6.5 million people have been entered
  into their national DNA databank
• This databank is the largest in the world and
  has participated in over 77 000 investigations

13
Taken from NDDB statistics page
http//www.nddb-bndg.org/stats_e.htm
14
Taken from NDDB annual report for 2006/2007
http//www.nddb-bndg.org/an_report_e.htm
15
Conclusion

• DNA holds all of the secrets of our bodies
• There are many ways that DNA can be used to
  identify and learn about other people
• It is an effective tool in crime solving
• The use of DNA databanks has caused major concern
  over the civil rights of convicted felons and
  possibly in the future, the civil rights of
  everyone
• If peoples DNA is exposed, there is concern for
  our privacy being violated

16
Bibliography

• Federal Bureau of Investigation. (2008). CODIS
  NDIS Statistics. Retrieved December 9, 2008,
  from http//www.fbi.gov/hq/lab/codis/clickmap.htm
  
• Fink, Sheri. (2006, July). Reasonable Doubt.
  Discover, 27(7), 54-59. Retrieved from EBSCO host
  database.
• Fridell, Ron. (2001). DNA Fingerprinting The
  Ultimate Identity. Toronto Franklin Watts.
• Genge, N.E. (2002). The Forensic Casebook. New
  York Ballantine Publishing Group.
• Human Genome Project Information. (2008). DNA
  Forensics. Retrieved November 10, 2008, from
  http//www.ornl.gov/sci/techresources/Human_Genome
  /elsi/forensics.shtml1
• Lampton, Christopher. (1991). DNA Fingerprinting.
  Boston Christopher Lampton.
• Learn Genetics. (2008). Can DNA demand a
  verdict?. Retrieved December 1, 2008, from
  http//learn.genetics.utah.edu/content/labs/gel/fo
  rensics/
• National DNA Databank. (2006). Welcome to the
  National DNA Databank Website. Retrieved November
  20, 2008, from http//www.nddb-bndg.org/main_e.ht
  m
• Zonderman, Jon. (1990). Beyond the Crime Lab.
  Toronto John Wiley and Sons.