Answers to Biotech Jeopardy PowerPoint PPT Presentation

presentation player overlay
1 / 9
About This Presentation
Transcript and Presenter's Notes

Title: Answers to Biotech Jeopardy


1
Answers to Biotech Jeopardy
2
  • Biotechnology Test Review Questions
  • Easy
  • Small, circular piece of bacterial DNA is called
    a ____.
  • Give two examples of vectors
  • The entire collection of genes within human cells
    is called the _______________.
  • Difference between technology and biotechnology?
  • Function of restriction enzymes?
  • HGP stands for? How many base pairs in HG? How
    many proteins?
  • Difference between surrogate and biological
    mother?
  • A _____________ is caused by a defective or
    mutant gene.
  • Define gene.
  • The first cell created by sexual reproduction is
    called a

3
  • Biotechnology Test Review Questions
  • Easy
  • Small, circular piece of bacterial DNA is called
    a ____.
  • Give two examples of vectors
  • The entire collection of genes within human cells
    is called the _______________.
  • Difference between technology and biotechnology?
  • Function of restriction enzymes?
  • HGP stands for? How many base pairs in HG? How
    many proteins?
  • Difference between surrogate and biological
    mother?
  • A _____________ is caused by a defective or
    mutant gene.
  • Define gene.
  • The first cell created by sexual reproduction is
    called a

4
  • Medium
  • 1. Inserting unrelated pieces of DNA together
    will result in ____________________.
  • 2. IVF stands for? What is a synonym used for
    IVF?
  • 3. What does transgenic mean?
  • 4. Identical twins are considered to be genetic
    ___________.
  • 5. How does IVF work? What does the female have
    to do? What does the male have to do?
  • 6. Why does IVF sometimes result in twins,
    triplets, or quads?
  • 7. Difference between fraternal vs. identical
    twins?
  • 8. How does Gel Electrophoresis separate DNA
    fragments?
  • 9. What is an example of a genetic disease?
  • 10. What kind of ethical questions arise from
    IVF?

5
  • Medium
  • 1. Inserting unrelated pieces of DNA together
    will result in ____________________.
  • 2. IVF stands for? What is a synonym used for
    IVF?
  • 3. What does transgenic mean?
  • 4. Identical twins are considered to be genetic
    ___________.
  • 5. How does IVF work? What does the female have
    to do? What does the male have to do?
  • 6. Why does IVF sometimes result in twins,
    triplets, or quads?
  • 7. Difference between fraternal vs. identical
    twins?
  • 8. How does Gel Electrophoresis separate DNA
    fragments?
  • 9. What is an example of a genetic disease?
  • 10. What kind of ethical questions arise from
    IVF?

6
  • Disease Huntingtons disease, sickle cell anemia,
    cystic fibrosis
  • Ethical questions
  • Will anyone be harmed?
  • What will be done with the extra embryos?
  • Who will pay the cost?
  • Do all involved parties agree?
  • Is it safe for the mother and embryo?

7
  • Difficult
  • What is the difference between gene therapy and
    genetic engineering?
  • Difference between a hybrid and chimera?
  • Steps of genetic engineering?
  • The Hind R1 restriction enzyme is used to slice
    DNA at the GAATTC between the G and C.
    Illustrate how this enzyme would precisely cut
    the fragment
  • ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA
  • TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT
  • What research can be done using gel
    electrophoresis?

8
  • Difficult
  • What is the difference between gene therapy and
    genetic engineering?
  • Difference between a hybrid and chimera?
  • Steps of genetic engineering?
  • The Hind R1 restriction enzyme is used to slice
    DNA at the GAATTC between the G and C.
    Illustrate how this enzyme would precisely cut
    the fragment
  • ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA
  • TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT
  • What research can be done using gel
    electrophoresis?

9
  • Hybrid has DNA from 2 organism in each cell
  • Chimera has cells from different organisms in the
    body
Write a Comment
User Comments (0)
About PowerShow.com