Goals of the Human Genome Project

1
Goals of the Human Genome Project

• determine the entire sequence of human DNA
• identify all the genes in human DNA
• store this information in databases
• improve tools for data analysis
• transfer related technologies to the private
  sector
• address the ethical, legal, and social issues
  (ELSI) that may arise from the project.

2
Sequencing a genome
Obtain Genomic DNA Sample
Sequence genomic DNA
Assemble sequences in order
Annotate sequence
3
Sanger Sequencing
Chemical reaction that includes DNA
polymerase DNA primer Nucleotide bases (A, T,
G, C) Nucleotide bases that are
labeled Addition of labeled bases stops
reaction. Repeated many times.
4
DNA separated by size using a gel and an electric
current
Sequenced sample put in well
_
DNA moves towards positive charge Short DNA
moves faster
5
How do we sequence a genome?
For the HGP, two approaches were used 1.
Hierarchical sequencing 2. Shotgun sequencing
6
How do we put the sequences together in the
right order?
Genome assembly - based on finding regions of
overlap between individual sequencing fragments
CCCATTAGATGCGATGGGTTAAAA
GGTTAAAAATCGATCCCATTTTACG

Very, very difficult problem for complex genomes!!
7
(No Transcript)
8
Genome Annotation

• Annotation identifying what part of DNA
  corresponds to genes, etc.
• Compare to known genes
• Gene already described and sequenced
• Expressed Sequence Tags (EST), essentially
  randomly sequenced mRNA
• Predict genes
• Computer predictions

9
Genome made of two types of DNA

• Euchromatic
• Comprises 93 of your DNA
• Contains most of the genes in your genome
• 99 has been sequenced
• Heterochromatic DNA
• Comprises 7 of your DNA
• Highly repetitive
• Some parts are structural contains centromeres,
  telomeres
• Gene sparse
• Very difficult to sequence, largely unexplored.

10
Euchromatic DNA

• 2.8 Billion base pairs
• 30,000 genes
• Many fewer than expected, initial guesses were
  100,000 genes
• 50 have unknown function
• Less than 2 of the total genome
• 98 junk DNA
• Does not code for genes
• Function is unknown - but potentially very
  important!!!
• Many (50) repeated sequences (e.g.
  AGAGAGAGAGAG) and transposable elements

11
What does the draft human genome sequence tell us?
How the genome is arranged Genes occur in
gene-dense jungles and gene poor deserts.  
Genes appear to be concentrated in random areas
along the genome, with vast expanses of noncoding
DNA between.   Chromosome 1 has the most genes
(2968), and the Y chromosome has the fewest
(231).
12
HapMap
An NIH program to map genetic variation within
the human genome

• Begun in 2002
• Construct a map of the patterns of variation
  that occur across human populations.
• Facilitate the discovery of genes involved in
  complex human traits and diseases.

13
Evolutionary Genomics - comparing genomes of
different species to learn about genome evolution
and function
Gene number does not directly scale with
complexity of organism!
14
What do evolutionary comparisons tell us?

• How the Human Compares with Other Organisms?
•   Humans have 3X as many kinds of proteins as
  the fly or worm
• mRNA transcript "alternative splicing" and
  chemical modifications to the proteins.
• This process can yield different protein products
  from the same gene.
• Large portions of non-genic DNA highly conserved,
  suggesting the serve some function.