Patenting Biomarker Inventions

1
Patenting Biomarker Inventions
Richard A. Nakashima
December 7, 2004
2
Technology Areas

• Gene Expression Analysis
• E.g., sequence specific probes, chip
  hybridization, sequence specific amplification,
  differential display, etc.
• Protein Arrays
• E.g., antibody chip, 2-D gel, antigen chip
  (endogenous Abs), etc.
• Genomic Analysis (individual/subpopulation
  variation)
• E.g., SNP, VNTR, STR, RFLP etc.

3
Examples of Discoveries

• Marker for a present disease state
• E.g., cancer marker (P53, P21, PSA, CA125, etc.)
• Causal mutation
• Surrogate marker (e.g., marker in linkage
  disequilibrium with causal mutation expression
  of surrogate is determined by causal mutation,
  etc.)
• Predictor for a future disease state
• E.g., predisposing mutation, genotype, etc.
• Surrogate end point marker
• E.g., responsiveness to drug therapy
• Expression of particular protein/peptide/mRNA
• Levels of metabolite, cytokine, hormone, cell
  type, etc.

4
Types of Claims

• Whoever invents or discovers any new and useful
  process, machine, manufacture, or composition of
  matter, or any new and useful improvement
  thereof, may obtain a patent therefore subject to
  the conditions and requirements of this title.
  35 U.S.C. 101
• - claims to process (method), machine
  (apparatus), manufacture or composition

5
Barriers to Patentability

• Product of Nature doctrine
• Utility Requirement
• Prior Art
• Lack of novelty
• Obviousness
• Other statutory bars (public use prior invention
  by another sale/offer for sale but not
  licensing)
• Section 112
• Enablement
• Written description
• Best mode requirement

6
Product of Nature Doctrine

• Cant patent things that exist in nature (e.g.,
  species of plant or animal, type of rock, etc.)
• However, isolated (purified) nucleic acids,
  proteins, eukaryotic cells, etc. do not exist in
  nature
• Transgenic cells, animals, plants, etc. also do
  not exist in nature

7
Utility Requirement

• Inventions in the biotech area must have a real
  world use in order to be patentable
• Cant patent a protein or nucleic acid sequence
  unless there is a plausible use for it
• E.g., use of EST sequence as a probe in order to
  clone a complete gene is not a real world use
  under the PTO guidelines
• Typically, in order to patent a protein/nucleic
  acid sequence, must know something about function
  of gene/protein
• Use as diagnostic/prognostic/drug
  responsiveness/surrogate end point marker are all
  real world uses

8
Anticipation (lack of novelty)

• A single prior art publication discloses each
  element of the claimed invention
• Prior art is anything that was publicly known
  before patent application filing date (priority
  date)
• Inventors own publications can count as prior
  art against a later-filed patent application
• The standards for a public disclosure are
  fairly low (reasonably accessible to person
  interested in field of invention)

9
Examples of publications

• A dissertation filed in a university or
  departmental library
• A published abstract
• A poster or slide show presented at a
  national/regional/local meeting
• A departmental seminar
• A funded federal grant application (Freedom of
  Information Act)
• A website pre-meeting compilation of abstracts
• A publication, including pre-printing
  availability on a website
• A published patent application or a patent
  application laid open for inspection
• A disclosure to a third party without
  confidentiality obligation

10
Obviousness

• Even if a single prior art publication does not
  disclose each element of a claimed invention, if
  two or more publications can be combined to
  disclose all elements of the invention, then they
  may preclude patentability due to obviousness
• If the differences between what was publicly
  known in the field and the elements of the
  claimed invention are insubstantial, this may
  also preclude patentability
• E.g., performing a previously known technique at
  a slightly different temperature, pH, etc.
• E.g., performing PCR analysis on a known cancer
  marker that had previously been examined only by
  RFLP
• Use of a previously characterized prostate cancer
  marker as a diagnostic marker for testicular
  cancer may or may not be considered obvious

11
Enablement

• Disclosure of patent application, combined with
  general knowledge in the field, must enable
  another skilled worker in the field to make and
  use the claimed invention without undue
  experimentation
• Routine experimentation is OK
• Must enable full scope of the patent claims
• A patent that disclosed the DNA sequence of rat
  insulin and generally discussed methods for
  cloning homologous sequences from other species
  did not enable a human insulin sequence
• The fact that a procedure/marker works in one
  kind of cancer doesnt mean you have enabled it
  for all types of cancer
• Biotechnology as PTOs favorite example of an
  unpredictable art
• higher standards for enablement and written
  description

12
Written Description Requirement

• Disclosure in patent application must be
  sufficient so that skilled worker in field,
  reading the application, would conclude that the
  inventor was in possession of the claimed
  invention as of application filing date
• University of Rochester v. G.D. Searle, Monsanto,
  Pharmacia Pfizer
• Issued patent claimed COX2 inhibitors and
  described a method for preparing transgenic cells
  containing COX2 protein and screening compounds
  for COX2 inhibition, but disclosed no actual COX2
  inhibitors
• Patent was found invalid for lack of written
  description
• A separate patent that claimed the screening
  method was not invalidated

13
Best Mode Requirement

• A patent applicant must describe best way known
  (or believed) to perform make and use claimed
  invention
• Cant hide the ball and still try to claim a 20
  year monopoly on patented subject matter (quid
  pro quo)

14
Consequences for Biomarker Patent Applications

• Composition claims to nucleic acid/protein
  sequences of use as markers may be anticipated
  (GenBank, EMBL, human genome project data, etc.)
• Example you discover that a protein (of
  sequence SEQ ID NO1) is overexpressed in
  cancer cells and/or is a surrogate end point
  marker for drug response, etc.
• SEQ ID NO1 has already been published as a
  putative translation product of a gene, even
  though it was not previously associated with
  cancer
• The publication of the sequence would preclude
  patenting a composition comprising a protein of
  SEQ ID NO1
• Under US patent law, composition claims are not
  limited by the intended use of the composition
• However, if the DNA sequence had been published,
  but it was not known that it encoded a protein,
  then composition claims to the protein would
  likely be allowed
• Also, if association with cancer was not
  previously known, you can still claim methods of
  use for detecting cancer and/or as surrogate end
  point

15
Publication before Patent Application May Result
in Loss of Patent Rights

• Immediate loss of patent rights in most foreign
  countries
• In US, 12-month window to file patent application
  after publication
• Usually, inventors own publications are the
  worst prior art
• Last sentence of abstract/poster/talk may support
  obviousness rejection

16
Example of Premature Publication

• A screening assay comparing leukemia and normal
  cell lines identifies a marker overexpressed in
  leukemia cells. No clinical data is available on
  whether marker is found in blood of individuals
  with leukemia is correlated with disease
  progression or is decreased in response to
  treatment with anti-cancer compounds.
• Preliminary results are presented at a meeting,
  the abstract states
• Although the present results indicate that
  marker X may be of use for diagnosis or prognosis
  of leukaemia or as a surrogate marker for
  therapeutic response to anti-leukemia agents,
  further studies are required in order to validate
  this marker in human cancer.
• Likely to support obviousness rejection of later
  filed patent application with clinical data

17
Enablement/Written Description Problems with
Preliminary Data

• A patent application claiming use of a biomarker
  for diagnosis or prognosis of cancer or as
  surrogate marker for therapeutic response, based
  only on cell line data with no clinical support,
  may be rejected for lack of enablement and/or
  written description support.
• What is the solution?

18
File Patent Applications in Stages

• A provisional US patent application may be filed
  before publishing preliminary results on cell
  line data
• Good for 12 months, never examined, can not
  result in issued patent
• Protects against inventors public disclosure of
  preliminary data
• Within 12 months, need to filed regular
  US/foreign patent application with any supporting
  clinical data
• Data acquired after 12 month period may be filed
  as a supporting declaration or a
  continuation-in-part patent application

19
Process Claims

• Examples
• 1. A method of detecting a disease
  state/predicting susceptibility or resistance to
  a disease state comprising
• a) obtaining a sample from a subject and
• b) testing the sample for the presence/concentra
  tion/increase/decrease of marker X
• A method of detecting response to a
  drug/predicting responsiveness to a drug
  comprising
• a) treating a subject with compound Y and
• b) determining the presence/concentration/increa
  se/decrease of marker X.

20
Composition Claims

• Examples
• 1. An isolated nucleic acid comprising a sequence
  selected from the group consisting of SEQ ID
  NO1, SEQ ID NO2 and SEQ ID NO3.
• SEQ ID NO1 AATGCGACGTAATTTGCAGCAG
• SEQ ID NO2 AATGCGACGTCATTTGCAGCAG
• SEQ ID NO3 CTAGCAGGCCTAGGGCTAGGCAAT
• An isolated protein comprising a sequence
  selected from the group consisting of SEQ ID NO1
  and SEQ ID NO2.
• An expression vector comprising an isolated
  nucleic acid selected from the group consisting
  of SEQ ID NO1, SEQ ID NO2 and SEQ ID NO3.
• A cell line transformed with an expression vector
  comprising an isolated nucleic acid selected from
  the group consisting of SEQ ID NO1, SEQ ID NO2
  and SEQ ID NO3.

21
Apparatus Claims

• Examples
• 1. An apparatus comprising
• a) a protein chip array and
• b) two or more antibodies attached to the array,
  said antibodies selected from the group
  consisting of MAb1, Mab2, Mab3, Mab4, Mab5 and
  Mab6.
• 2. The apparatus of claim 1, further comprising a
  spectrophotometer designed to detect fluorescence
  emissions from the protein array chip.