Immunoassay is the fundamental analytical technology relied upon for accurate diagnosis of disease'

1
MCA-SAQSSE A Highly Sensitive Immunoassay
Technology David T. McCreavy, James A.
Gallagher, William D. Fraser PalindromX Group,
Departments of HACB and Clinical Chemistry,
University of Liverpool, Sherrington Buildings,
Liverpool L69 3GE. Author for Correspondence
David T. McCreavy email davit_at_liv.ac.uk 0044
151 794 7526
Introduction Immunoassay is the fundamental
analytical technology relied upon for accurate
diagnosis of disease. Successive generations of
immunoassays have seen impressive increases in
sensitivity (the least detectable quantity),
but still greater sensitivity remains a core goal
in the ability to achieve earlier diagnosis of
disease, and thereby improve prognosis and reduce
healthcare costs. For example, first
generation TSH (thyroid stimulating hormone)
assays measured down to 5 mIU/L and, thirty years
later, current third and fourth generation
assays achieve ca 0.005 mIU/L, a 1000-fold
increase. For many analytes of clinical
importance, a further increase in sensitivity of
the same or greater magnitude is sought. This
will not be achieved using conventional
signalling methods. Recently immunoassays using
DNA labeled reporter antibodies have been
developed. These take advantage of the high
specific activity of polymerase chain reaction,
which can amplify an individual label in the
region of a million-fold. Utilising this
technology substantial increases in sensitivity
and multiple analyte immunoassays have been
demonstrated. To further improve this technology
particularly with reference to its multi-analyte
facet a new design has been produced that will
potentially enable twenty analytes to be measured
simultaneously from the same sample, moreover the
design will enable a modular approach in which it
is envisaged that an end user will specify the
analytes to be measured from a large panel.
Presented here are the key concepts of the
design together with data from a single analyte
immunoassay which demonstrate its increased
sensitivity and potential. Design The design
that has been developed termed Melt Curve
Analysis Single Analyte Quantitation through
Single Strand Extension (MCA-SAQSSE) is a
marriage of traditional immunoassay and PCR
melt-curve analysis. This technology utilises
direct labelling of the detector antibody with a
small DNA molecule (the key). After formation
of the antibody-protein-antibody complex, a large
complementary DNA molecule is added (the lock)
which engages the key, and as a combined lock
and key can be specifically amplified by a
palindromic primer and quantified using specific
signal probes and melt-curve analysis. See
Figures 1(A-D). Materials Methods Coating
Plates Nunc Maxisorp plates were coated with anti
TSH monoclonal antibodies at a concentration of
5mg/L overnight at room temperature, blocked for
1hr at room temperature with BSA and air dried
for 2hrs. Conjugation of oligonucleotide to
anti-TSH monoclonal antibody Anti-TSH monoclonal
antibodies were cleaved at the hinge region using
2-mercaptoethylamine (Perbio), desalted.
Concurrently 5 amino modified oligonucleotides
(Oswel) were derivatised using S-SMCC (Perbio)
and desalted. The solutions were concentrated,
combined and incubated at room temperature for
2hrs. Conjugates were purified using Protein G
and ion-exchange chromatography. Biotinylation
of anti-TSH monoclonal antibody Anti-TSH
monoclonal antibody was biotinylated using
biotinamidocaproate NHS ester in DMF and the
reaction was stopped with ethanolamine before
desalting with a PD10 column. ELISA 100ul of
human TSH (Scipac) diluted in either
TBS-0.1Tween5 polyp (buffer) or porcine serum
was added to coated wells and incubated for 2hrs
at room temperature with agitation. After 6
washes with TBS-Tween , 100ul anti-TSH-oligo
conjugate was diluted 110k in TBS-0.1Tween5
polyp or 100ul anti-TSH-biotin conjugate was
diluted to 1ug/ml and incubated for 2hrs at room
temperature with agitation. After 6 washes with
TBS-Tween the plates were subject to either TMB
or PCR processing TMB Processing 100ul Avidin D
HrP diluted to 200ng/ml in TBS-0.1Tween5 polyp
was added to the wells and incubated for 45
minutes, after 6 washes with TBS-Tween, TMB
substrate was added and the plate incubated at
room temperature for 30 mins before reading. PCR
Processing 100ul dissociation solution was added
to the wells and incubated for 20mins. 2ul was
added to 18ul of reaction mix in a Lightcycler
capillary (Roche) and the reaction cycled.
Results In comparisons with the HrP-TMB substrate
ELISA the MCA-SAQSSE was substantially more
sensitive. When using a buffer system and
8000-fold increase in sensitivity has been
observed whilst in the porcine system at least a
400-fold increase has been observed see Figure 2,
cvs are comparable with the traditional HrP-TMB
format see Figure 3. Discussion These results
demonstrate that the MCA-SAQSSE technique is
capable of improving the sensitivity of
immunoassay by 400-8000 fold dependent upon
matrix. Moreover the format of the technique is
simple and will lend itself to high-throughput.
Preliminary data (note shown) suggests that up to
five DNA labels can be identified and quantified
per channel on a real-time PCR thermocycler using
MCA enabling up to 20 analytes to be
summultaneously measured on a typical four
device. A set of DNA labels are currently being
evaluated to allow a multiple analyte version of
the assay to be developed and steps are being
taken to further improve the sensitivity of the
porcine diluent assay prior to undertaking a
rigorous evaluation using a high-throughput
platform.
A
B
agaaggtgtctgcgggagGcgatttcatcatcacgcagcttttctttgag
gctgacacattcttccgcttt agaaggtgtctgcgggagCcgattt
catcatcacgcagcttttctttgaggctgacacattcttccgcttt
Tm 50.6
Tm 62.3  
C
0.000156 0.003125 1.25uIU/ml X8000 X400
Figure 2 Comparison of HrP-TMB and MCA SAQSSE in
Buffer and Porcine
D

• Figure 1 Overview of the MCA-SAQSSE Process
• The oligonucleotide attached to the detector
  antibody is extended using a specific template,
  to produce annealing sites to facilitate
  amplification using the palindromic primer.
• The unique Tm of the specific combinations of
  oligonucleotide and template provide a mechanism
  to differentiate and quantitate multiple
  immunosandwiches.
• Using meltcurve analysis (MCA) specific
  immunosandwiches can be identified and quantified
  using best fit and area under the curve software.
• Resultant areas can be plotted

Figure 3 Typical cv using the MCASAQSSE Technique