Case Studies

1
Case Studies 2Hospice Outbreak

• Hana Lim Carol Chaffee

2
Scenario

• 42 patients and entire of kitchen dish washing
  staff at Philadelphia Hospice complained of
  chronic diarrhea, vomiting and flu-like symptom
  since a plumbing repair on Jan. 7.
• Two children developed flu-like symptoms since
  they began spending the day with their
  grandparents at the center since Jan. 10.
• Four nurses were sent home complaining of
  debilitating nausea and confusion on Jan. 22.
• Three out of 42 elderly-patients is being
  transported to ICU for close monitoring.

3

• Two out of three elderly patients in ICU died of
  pneumonia and the third patient is responding to
  treatment and has stabilized.
• Four more patients admitted to the hospital with
  body temperatures over 103 F.
• 20 other elderly went back home complaining of
  fatigue, headache and nausea.
• The nurses still feel tired and they cough
  frequently during smoke break.
• Kitchen staff are better, however, complain of
  confusion

4
Hypothesis

• Legionella
• Aquatic biofilms
• Symptoms appear within 2-10 days after exposure
• Headache, nausea, vomiting, and stomach
  discomfort
• For several days, the patient may feel tired and
  weak.  Most patients who are admitted to the
  hospital develop high fever often greater than
  39.5C (103F)
• Legionellosis is an infectious disease caused by
  bacteria belonging to the genus Legionella which
  takes two distinct forms
• Legionnaires disease Pneumonia
• Flu-like Pontiac fever

5
Further information

• How many of the patients, nurses, and kitchen
  staff are smokers?
• 9 of 42 patients, all 4 nurses, and none of 5
  dishwashers were smokers
• Are the patients who have been affected suffering
  from other conditions that may have impaired
  their immune system or lung function?
• Two resident patients who died suffered from lung
  cancer
• The third patient has emphysema and was sent home
  on oxygen
• The four later admitted to the hospital are
  considered to have impaired immune system
• The Nature of the plumbing repairs? Were any
  water tanks, especially hot water reservoirs,
  involved?
• Yes
• Have any other people in the households of
  affected individuals developed any symptoms?
• No. None of the households of the infected
  individuals have reported symptoms

6
Culture-based technique

• Phlegm samples that were produced by affected
  individuals Water samples from inside of faucet
• Buffered Charcoal Yeast Extract (BCYE)Agar
  L-Cysteine Fe
• 5 days _at_ 37C
• Result
• There were colonies growth
• Characteristic Legionella colonies white-gray to
  blue-gray

7
PCR test

• MoBioClean Microbial DNA Isolation Kit
• Primer set was designed This primer set targets
  a large number of Legionella variants, but does
  not amplify non-Legionella organism.
• Band appearing at approx. 1000 bp on a gel may be
  presumed Legionella.
• Target gene hsp60(specific gene that can be
  found in Legionella)
• Forward Primers TGTTGAAGGTCACAAGGCAG
• Reverse Primers CACCGGCAACAATACCTTCT
• All PCR products had be run on a 1.2 agarose gel
  with TAE buffer and we expected a correctly sized
  product that appear at approximately 1000 bps

8
DNA extracts (Colonies, phlegm, water, and
controls)

• The purified DNA from Colonies, Phlegm, and water
  sample went into PCR reaction
• As controls, DNA extracts from pure cultures of
  any Legionella strain (Positive control),
  Streptococcus pneumoniae and E. coli (negative
  controls) were tested too.

9
Result from PCR test

• Two of the three types of colonies from which DNA
  was extracted showed a distinct band at 944 bps
• 16 out of 18 gels of DNA from phlegm samples of
  18 individual patients also showed dark bands at
  approximately 944 bps.
• The PCR detection failed from the water samples.
• The amount of DNA extracted from these samples
  was below detectable levels.
• Neither negative control showed a product at 1000
  bps, while the positive control showed a
  distinct, dark band at 944 bps.

10
Conclusion

• It is clearly proved that this outbreak was
  caused by Legionella!