Regulation of Gene Expression

1
Regulation of Gene Expression
J. Paul Simon
2
Learning Objectives

• Describe the difference between
• Constitutive and regulated gene
  expression Induction and repression of genes
• Describe the elements of the prokaryotic operon.
• Describe the following
• Enhancer
• Transactivator
• Coactivator
• Chromatin remodeling

3
4. Describe, in general terms, the regulation of
gene expression with reference to transcription,
translation, and alternative splicing. 5.
Identify the differences, in general terms,
between positive and negative regulation with
respect to the function of the regulatory protein
(DNA-binding protein) and the signal molecule. 6.
Describe mRNA editing for the apolipoprotein
B-100 gene in the intestine. 7. Identify the
seven major process where regulatory controls can
act to modulate the concentration of the final
gene product (protein).
4
Gene regulation is required for adaptation to
the environment (nutrient supply, temperature,
chemical toxins, other forms of stress, DNA
damage) development and cell differentiation to
conserve energy
5
Life cycle of the fruit fly Drosophila
melanogaster
More genes are expressed during development than
at any other time.
6
gene expression transcription, and in the case
of proteins, translation, to yield the product of
a gene. A gene is expressed when its final
biological product is present and active.
7
The cellular concentration of a protein (i.e. the
gene product) is determined by a balance of at
least seven major processes
The most efficient place for regulation is at the
beginning of a pathway.
8
Some definitions
housekeeping genes Genes for products that are
required at all times are expressed at a more or
less constant level (i.e. TCA cycle enzymes).
The unvarying expression of a gene is called
constituitive expression.
regulated gene expression when the level of a
gene product (protein or RNA) rises and falls in
response to molecular signals.
induction an increase in level of gene product,
i.e. a protein. repression a decrease in level
of gene product.
9
Regulation of gene expression in prokaryotes
Transcription is mediated and regulated by
protein-DNA interactions, especially those
between the protein components of RNA polymerase
and DNA.
promoter a DNA sequence at which RNA polymerase
may bind, leading to the initiation of
transcription.
Consensus sequence for many E. coli promoters
upstream promoter (UP) element an AT rich
recognition element found in the promoters of
certain highly transcribed genes.
10
In prokaryotes.genes are often regulated in
units called operons.
operon the gene cluster and promoter plus
additional sequences that function together in
regulation.
operator specific sites on DNA where repressor
molecules bind usually near a promoter. activator
binding site specific sequence where
transcriptional activator molecules bind.
11
Common patterns of transcriptional regulation
Repressor (red) is bound to the operator in the
absence of the molecular signal. The external
signal causes dissociation of the repressor to
permit transcription.
12
Common patterns of transcriptional regulation
Repressor is bound in the presence of signal.
When signal is removed, repressor dissociates and
permits transcription.
13
Common patterns of transcriptional regulation
Activator (green) binds in the absence of signal
and transcription proceeds. When the signal is
added, activator dissociates and transcription is
inhibited.
Activator binding site on DNA
14
Common patterns of transcriptional regulation
Activator binds only in the presence of signal
it dissociates when signal is removed thus
inhibiting transcription.
15
Note
The terms positive regulation and negative
regulation refer to the action or function of
the regulatory protein. Not the signal
molecule. The bound regulatory protein either
inhibits (negative regulation) or activates
(positive regulation) transcription. The signal
molecule determines whether the regulatory
protein is bound or not, or in some cases effects
its conformational state to achieve the same
result.
Positive regulation is particularly common in
eukaryotes.
16
Lactose metabolism in E. coli
Uptake and metabolism of lactose requires the
activities of galactoside permease and
b-galactosidase.
Conversion of lactose to allolactose by
transglycosylation is a minor, but important,
reaction also catalyzed by b-galactosidase
17
The lac operon is subject to negative
transcriptional regulation
b-galactosidase gene
galactoside permease gene
main operator for lac operon
transacetylase gene
one of two pseudooperators
18
Negative regulation of the lac operon follows
this pattern
Repressor (red) is bound to the operator in the
absence of the molecular signal. The external
signal causes dissociation of the repressor to
permit transcription.
19
The I gene encodes the Lac repressor protein. It
is transcribed separately from its own promoter,
PI.
lac operon in repressed state
b-galactosidase gene
galactoside permease gene
main operator for lac operon
transacetylase gene
one of two pseudooperators
20
The Lac repressor
The repressor protein is a tetramer of identical
subunits.
To repress the Lac operon, the repressor binds to
the main operator and one of the two
pseudooperators with the intervening DNA looped
out.
Despite this elaborate binding, repression is not
absolute. A few molecules of the lactose
metabolizing enzymes are still made. This basal
level of transcription is essential to operon
regulation.
21
Basal transcription of the lac operon In the
absence of the signal molecule.
22
The signal molecule (inducer) for the lac operon
is allolactose.
Without lactose in the medium, the basal level of
transcription produces of few molecules of the
lac operon enzymes. When lactose becomes
available, the permease and b-galactosidase
already present produce some allolactose. This
binds to the repressor. Release of the Lac
repressor caused by allolactose allows the lac
operon genes to be expressed and leads to a 1000
fold increase in the concentration of
b-galactosidase .
23
The Lac repressor with and without the bound
artificial inducer isopropylthiogalactoside (IPTG)
The transparent image is without bound IPTG.
Note the two helix-turn-helix motifs. It is
thought that these bind in the major groove of
the DNA near the operator.
Binding of IPTG produces the overlaid solid
structure. When IPTG is bound, the DNA binding
domains are no longer defined in the crystal
structure.
24
Relationship between lac operator sequence and
Lac promoter binding
AATTGTGAGCGGATAACAATT
The bases in black exhibit twofold (palindromic)
symmetry about the axis indicated by the vertical
arrow.
25
Lactose
Allolactose
In the presence of lactose, the basal level of
b-galactosidase produces allolactose.
Allolactose binds to the Lac repressor and shifts
the binding equilibrium such that the repressor
is very poorly bound. This increases the rate of
transcription.
26
The lac operon is also subject to positive
regulation
Other factors besides lactose availability effect
the expression of the lac operon genes.
Glucose, metabolized directly by glycolysis, is
E. colis preferred energy source. Other sugars
can be utilized, but extra energy consuming steps
are necessary. catabolite repression a
regulatory mechanism that prevents the expression
of genes for lactose, arabinose, and other sugars
in the presence of glucose, even when these
secondary sugars are also present.
27
The effect of glucose on the lac operon is
mediated by two components cyclic AMP
(cAMP) cAMP receptor protein (CRP)
(also called the catabolite activator
protein)
CRP is a dimeric protein that binds DNA and cAMP.
Bound molecules of cAMP are in red. Note the
bending of the DNA (blue and white) around the
protein. The region that interacts with RNA
polymerase is in yellow.
28
CRP has a cAMP binding site. The concentration
of cAMP changes the conformation of CRP and
effects the binding of CRP to the CRP binding
site near the lac promoter. High levels of cAMP
promote strong binding of CRP to the CRP
site. Glucose concentration effects the levels of
cAMP. When the glucose concentration is low,
cAMP concentration is high. And conversely, when
glucose is abundant, cAMP is low in concentration
in the cell. Therefore. high glucose low
cAMP poor binding of CRP low glucose
high cAMP strong binding of CRP
29
Catabolite repression the effect of glucose
concentration on the transcriptional regulation
of the lac operon
30
Gene Regulation in Eukaryotes
In bacteria, RNA polymerase can access any
promoter, and some mRNA is produced even in the
absence of activators. The ground state of
transcription is nonrestrictive. In eukaryotes,
promoters are generally inactive in the absence
of regulatory proteins. The ground state is
restrictive. Initiation of transcription is
almost always dependent upon the action of
multiple activator proteins. In other words, most
eukaryotic promoters are positively regulated.
31
Important regulatory differences between
prokaryotes and eukaryotes
1. Access to eukaryote promoters is restricted by
chromatin.
2. Positive regulatory elements predominate in
eukaryotes. Virtually every eukaryotic gene
requires activation to be transcribed.
3. Eukaryotic cells have larger, more complex
multimeric regulatory proteins than bacteria.
4. In eukaryotes, transcription is separated both
in space and time from translation in the
cytoplasm.
32
Transcription of a eukaryote gene is strongly
repressed when its DNA is condensed within
chromatin.
Chromatin remodeling the transcription-associated
structural changes in chromatin
Histone acetylation occurs in the nucleus where
chromatin is being activated for transcription.
Histone acetyltransferases acetylates lysine
residues in histones. When multiple lysines are
acetylated, the nucleosome has reduced affinity
for DNAit can unwind and expose the DNA to
regulatory proteins and RNA polymerase.
33
Common sequences recognized by eukaryotic RNA
polymerase II
The TATA box is the major assembly point for the
proteins of the preinitiation complex. The DNA
is unwound at the initiator sequence (Inr), and
the start site is usually close by. Some
promoters lack the TATA box or the Inr sequence
or both.
An average RNA polymerase II promoter may be
effected by a half-dozen regulatory sequences,
and even more complex promoters are quite common.
34
Enhancers
The additional regulatory sequences in eukaryotic
promoters are called enhancers in higher
eukaryotes, and upstream activator sequences
(UAS) in yeast. A typical enhancer may be
hundreds or thousands of base pairs upstream from
the transcription start site, or it may be
downstream within the gene itself. When bound by
the appropriate regulatory proteins, an enhancer
increases transcription.
35
Three classes of proteins are involved in
transcriptional activation
1. basal transcription factors proteins
required at every RNA polymerase II promoter
(TFIIs) 2. DNA-binding transactivators
proteins that bind to the DNA sequences of
enhancers or UAS 3. coactivators proteins that
act indirectly, not by binding to DNA, and are
required for essential communication between the
DNA-binding transactivators and the complex
composed of the basal transcription factors and
RNA polymerase II. A variety of repressor
proteins can interfere with this communication,
resulting in repression of transcription.
36
The number and type of regulatory elements varies
with each mRNA. Different combinations of
transcription factors also can exert differential
regulatory effects upon transcriptional
initiation. The various cell types each express
characteristic combinations of transcription
factors. This is one of the major mechanisms for
cell-type specificity in the regulation of gene
expression.
37
Preinitiation complex at eukaryotic promoter
TBP TATA binding protein Basal Transcription
factors (TFIIB, TFIIE, TFIIF, TFIIH) RNA
polymerase II
38
CTD carboxyl terminal domain HMG high mobility
group proteins
39
Eukaryotic transcriptional repressors function by
a variety of mechanisms. Some bind directly to
DNA, displacing a protein complex required for
activation others interact with various parts of
the transcription complexes to prevent activation.
40
tropomyosin a heterodimer whose two homologous
helical subunits wrap around each other to form a
coiled coil involved in the regulation of muscle
contraction.
calcitonin a 33 residue polypeptide synthesized
by specialized thyroid gland cells decreases
serum Ca levels by inhibiting the resorption of
Ca from bone and kidney.
calcitonin gene-related protein a neuropeptide
may function as a neurotransmitter in the brain.
41
Two mechanisms for the alternative processing of
complex transcripts in eukaryotes in both
mechanisms different mature RNAs are produced
from the same primary transcript.
42
Alternative splicing pathways that give rise to
cell-specific a-tropomyosin in the rat
STR 3 UT
5 UT
3 UT
SM
STR
STR
mRNA transcripts
Striated muscle
Smooth muscle
Striated muscle
Myoblast
Fibroblast
Hepatoma
Brain
43
Alternative splicing of the rat calcitonin gene
(CGRP calcitonin gene-related protein)
44
RNA Editing
RNA editing of the transcript for the
apolipoprotein B-100 gene. A cytosine deaminase
found only in the intestine binds to the mRNA at
codon 2,153 (CCAGln) and converts the C to a U.
This converts a gln to a stop codon and produces
a truncated protein, apolipoprotein B-48.
45
Translational regulation in eukaryotes
Regulation at the level of translation assumes a
much more prominent role in eukaryotes than in
bacteria. Transcripts generated in the
eukaryotic nucleus must be processed, and then
transported to the cytoplasm for protein
synthesis on the ribosomes. This can cause a
delay in the appearance of a protein. Some very
long eukaryotic genes (a few are measured in the
millions of base pairs) can take several hours
for transcription and processing. When a rapid
increase in protein production is needed, a
translationally repressed mRNA already in the
cytoplasm can be activated for translation
without delay.
46
Eukaryotes have at least three major mechanisms
for translational regulation
1. Translation initiation factors are subject to
phosphorylation by a number of kinases. The
phosphorylated forms are often less active, and
cause a general depression of translation. 2.
Some proteins bind directly to mRNA transcripts
and act as translational repressors. Many bind at
the 3 untranslated region (3 UTR) of mRNA.
47
Protein complexes in the formation of a
eukaryotic translational initiation complex
The 3 and 5 ends of eukaryotic mRNAs are linked
by a complex of proteins that includes several
initiation factors and the poly(A) binding
protein (PAB).
The e stands for eukaryotic initiation factor.
48
Translational regulation of eukaryotic mRNA
A major mechanism for translational regulation in
eukaryotes involves the binding of translational
repressors (RNA-binding proteins) to specific
sites in the 3 untranslated region of the mRNA.
These proteins interact with eukaryotic
initiation factors or with the ribosome to
prevent or slow initiation.
49
3. Binding proteins, present in eukaryotes from
yeast to mammals, disrupt the interaction between
eIF4E and eIF4G. The mammalian versions are
called 4E-BPs. When cell growth is slow, 4E-BPs
bind to the site on eIF4E that
4E-BPs
normally interacts with eIF4G. When cell growth
resumes or responds to growth factors or other
stimuli, the binding proteins are inactivated by
protein kinase-dependent phosphorylation.
50
The role of eIF-2 in the initation of eukaryotic
translation
GDP does not spontaneously dissociate from eIF-2
(as in prokaryotes)
51
eIF-2 is regenerated via eIF-2B and then it
becomes available to initiate another round of
translation
52
Translational regulation in reticulocytes by heme
availability
HCI heme-controlled inhibitor also called
heme-controlled repressor functions as a serine
kinase to phosphorylate eIF-2
Phosphorylated eIF-2 forms a stable complex with
eIF-2B. This ties up eIF-2B and prevents
regeneration of eIF-2. Without eIF-2, translation
halts.
53
Interferon
There are three types of interferon type a or
leucocyte (white blood cell) interferon type b or
fibroblast (connective tissue) interferon type g
or lymphocyte (immune cell) interferon (modulates
the immune system) Interferon synthesis is
induced by double-stranded RNA (dsRNA) which is
probably generated by virial infection.
Interferons are effective at very low
concentrations. They are among the most potent
biological substances known. Interferons act to
inhibit protein synthesis.
54
Mechanism of action of interferon
Interferons induce the production of a protein
kinase that phosphorylates eIF-2. This inhibits
translation by the same mechanism as regulation
by heme availability in red blood cells.
55
Interferon also induces the production of an
enzyme 2,5-oligoadenylate synthetase which
produces an unusual oligonucleotide (2 to 10
adenylate nucleotides joined by a 2 to 5
phosphodiester linkage) in the presence of dsRNA.
2,5A activates RNase L which degrades mRNA and
inhibits protein synthesis.
56
Induction of the SOS response in E. coli
SOS response a cellular stress response to
extensive DNA damage. This is an example of
coordinated induction of many distantly located
genes in response to unusually heavy DNA damage,
i.e. exposure to strong UV light. This repair
is, in many instances, error-prone the repair is
not accurate and a high mutation rate
results. The E. coli cell lives to divide. Heavy
DNA damage halts replication. The SOS response is
a desperation strategy to overcome a nearly
insurmountable barrier to cell division.
57
The LexA repressor protein inhibits transcription
of all SOS genes, and induction of the SOS
response requires removal of LexA. This is not a
simple dissociation. The LexA repressor is
inactivated when it catalyzes its own proteolytic
cleavage at a specific ala-gly peptide bond.
This cleavage requires a coprotease called RecA.
RecA facilitates cleavage of LexA only when it
is bound to single-stranded gaps in damaged DNA.
58
When DNA is extensively damaged, replication
halts, and the number of single-stranded gaps
increases.
RecA binds to these gaps and its coprotease
activity is activated.
E. coli chromosome
RecA then facilitates cleavage of the LexA
repressor. This inactivates LexA and the SOS
genes including RecA are induced.